125742 S2 M5 5.4 singh dk 2020

Pfizer Documents (PHMPT/FDA)

Pfizer Bla Submission

Pfizer 16 Plus Documents

88

Document text

Title: SARS-CoV-2 infection leads to acute infection with dynamic cellular and inflammatory flux 1 
in the lung that varies across nonhuman primate species  2 
Authors: Dhiraj Kumar Singh1,2, Shashank R. Ganatra1,2, Bindu Singh1,2, Journey Cole1,2, Kendra J. 3 
Alfson2, Elizabeth Clemmons1,2, Michal Gazi2, Olga Gonzalez1,2, Ruby Escobedo1,2, Tae-Hyung 4 
Lee1,2, Ayan Chatterjee1,2, Yenny Goez-Gazi2, Riti Sharan1,2, Rajesh Thippeshappa1,2, Maya 5 
Gough1,2, Cynthia Alvarez1,2, Alyssa Blakley1,2, Justin Ferdin1,2, Carmen Bartley1,2, Hilary Staples1,2, 6 
Laura Parodi1,2, Jessica Callery1,2, Amanda Mannino1,2, Benjamin Klaffke2, Priscilla Escareno2 , Roy 7 
N. Platt II2, Vida Hodara1,2, Julia Scordo2, Adelekan Oyejide3, Dharani K. Ajithdoss3, Richard Copin3, 8 
Alina Baum3, Christos Kyratsous3, Xavier Alvarez1,2, Bruce Rosas4, Mushtaq Ahmed4, Anna 9 
Goodroe1,2, John Dutton1,2, Shannan Hall-Ursone1,2, Patrice A. Frost1,2, Andra K. Voges5, Corinna 10 
N. Ross1,2, Ken Sayers1,2, Christopher Chen1,2, Cory Hallam2, Shabaana A. Khader4 , Makedonka 11 
Mitreva4, Timothy J. C. Anderson2, Luis Martinez-Sobrido2, Jean L. Patterson2, Joanne Turner2, 12 
Jordi B.Torrelles2, Edward J. Dick , Jr.1,2, Kathleen Brasky1,2, Larry S. Schlesinger1,2, Luis D. 13 
Giavedoni1,2#, Ricardo Carrion, Jr.1,2#,  Deepak Kaushal1,2#14 
Affiliations: 1Southwest National Primate Research Center, 2Texas Biomedical Research Institute, 15 
San Antonio, TX, 78227, 3Regeneron Pharmaceuticals, Inc., Tarrytown, NY 10591; 4Washington 16 
University in St Louis School of Medicine, St Louis, MO; 5Veterinary Imaging Consulting of South 17 
Texas, San Antonio, TX, 78258. 18 
#To whom correspondence may be addressed: Deepak Kaushal, PhD, Director, Southwest 19 
National Primate Research Center, Professor, Texas Biomedical Research Institute, 8715 W. 20 
Military Drive, San Antonio, TX, 78227, Email: [email protected],  Tel. (2 10)258 -9209; OR 21 
Ricardo Carrion, Jr., PhD, Professor, Texas Biomedical Research Institute, 8715 W. Military Drive, 22 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148828
San Antonio, TX, 78227; Email: [email protected], Tel. (210)258 -9479 OR Luis D. Giavedoni, 23 
PhD, Professor, Texas Biomedical Research Institute, 8715 W. Military Drive, San Antonio, TX, 24 
78227, Email: [email protected], Tel. (210)258-9603.  25 
Abbreviations: COVID-19, Coronavirus disease 2019; SARS-CoV-2, Severe Acute Respiratory 26 
Syndrome Coronavirus-2; BAL,  bronchoalveolar lavage; PFU, Plaque Forming Unit; CRP, C- 27 
reactive protein; CXR, thoracic radiograph; NHP, nonhuman primate; PBMC, peripheral blood 28 
mononuclear cell; dpi, days post-infection. 29 
Key words : COVID-19, SARS-CoV-2, nonhuman primates, rhesus macaques, baboons, marmosets, 30 
animal models, BAL, CT 31 
 32 
Summary   33 
There are no known cures or vaccines for COVID- 19, the defining pandemic of this era. Animal 34 
models are essential to fast track new interventions and nonhuman primate (NHP) models of 35 
other infectious diseases have proven extremely valuable. Here we compare SARS-CoV-2 36 
infection in three species of exp erime ntally infected NHPs (rhesus macaques, baboons, and 37 
marmosets). During the first 3 days, macaques developed clinical signatures of viral infection and 38 
systemic inflammation, coupled with early evidence of viral replication and mil d-to-moderate 39 
interstitial and alveolar pneumonitis, as well as extra-pulmonary pathologies. Cone-beam CT 40 
scans showed  evidence of moderate pneumonia, whi ch progressed over 3 days. Longitudinal 41 
studies showed that whi le both young and old macaques dev eloped early signs of COVID-19, both 42 
groups recovered  within a two-week period.  Recovery was characterized by low-levels of viral 43 
persistence in the lung, suggesting mechanisms by which individuals with compromised immune 44 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148829
systems may be susceptible to prolonged and progressive COVID-19. The lung compartment 45 
contained a complex early inflammatory milieu with an influx of innate and adaptive immune 46 
cells , particularly interstitial macrophages, neutrophils and plasmacytoid dendritic cells, and a 47 
prominent Type I-interferon response . While macaques developed moderate disease, baboons 48 
exhibited prolonged shedding of virus and extensive pathology following infection; and 49 
marmosets demonstrated a milder form of infection. These  results showcase in critical detail, the 50 
robust  early cellular immune responses to SARS-CoV-2 infection, which are not sterilizing and 51 
likely impact development of antibody responses. Thus, various NHP genera recapitulate 52 
heterogeneous progression of COVID-19. Rhesus macaques and baboons develop different, 53 
quantifiable disease attributes making them immediately available essential models to test new 54 
vaccines and therapies. 55 
 56 
Main 57 
A novel coronavirus, designated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), 58 
emerged in Wuhan, China in 2019, and was proven to be the cause of an unspecified pneumonia. 59 
It has since spread globally, causing Coronavirus Disease 2019 (COVID-19) 1. The World Health 60 
Organization (WHO) declared COVID-19 a pandemic. It is clear that community spread of SARS- 61 
CoV-2 is occurring rapidly and the virus has very high infectivity and transmission rates, even 62 
compared to SARS-CoV-1, the causative agent of an outbreak 15 years earlier. It has been 63 
estimated that between up to 250,000 American lives may be lost due to COVID-19. The world 64 
over, these numbers could be 10-50 times worse. Clearly, COVID-19 is the most defining 65 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148830
pandemic of this era, requir ing significant biomedical research input, in order to most effectively 66 
fast track the development of new therapies and vaccines.  67 
 68 
Human COVID-19 disease presents with a broad clinical spectrum ranging from asymptomatic to 69 
mild and severe cases. Patients with COVID pneumonia exhibit high-grade pyrexia, fatigue, 70 
dyspnea and dry cough accompanied by a rapidly progressing pneumonia, with bilateral opacities 71 
on x-ray and patchy, ground glass opacities on lung Computed Tomography (CT) scans. Individuals 72 
with immunocompromised conditions and comorbidities are at highest risk for worse outcomes 73 
of COVID-19.  74 
 75 
Nonhuman primate (NHP) models of infectious diseases have proven useful for both investigating 76 
the pathogenesis of infection and testing therapeutic and vaccine candidates 2. During the SARS 77 
and MERS outbreaks, NHP models were developed with a moderate degree of success3. Early 78 
reports also indicate the utility of NHPs for SARS-CoV-2 infection, and for evaluating vaccine 79 
candidates4,5,6,7. We hypothesized that the heterogeneity of human responses to SARS-CoV-2 80 
infection can be recapitulated using  multiple NHP species. Furthermore, we sought to gain a 81 
detailed characterization of the early cellular immune events following SARS-CoV-2 infection in 82 
the lung compartment, which  has not yet been reported. Here, we compare SARS-CoV-2 infection 83 
in three species of NHPs (Specific Pathogen-free [SPF]  Indian rhesus macaques, African-origin 84 
baboons, and N ew-World origin common marmosets). We assess age as a variable and focus our 85 
studies on high resolution imaging and the critical nature of the early cellular immune response 86 
in the lung which likely impacts disease outcome.  87 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148831
 88 
Early events in SARS-CoV-2 infection in rhesus macaques  89 
We first assessed the ability of SARS-CoV-2 to infect rhesus macaques during an acute 3-day 90 
infection study. Four  Indian-origin mycobacteria- and SPF-naïve rhesus macaques (Macaca 91 
mulatta) (Table S1) were infected by multiple routes (ocular, intratracheal and intranasal) with 92 
sixth-passage virus at a target dose of 1.05x106 PFU/per animal. All animals developed clinical 93 
signs of viral infection as evidenced by a doubling of serum  C-Reactive Protein (CRP) levels 94 
relative to baseline, indicating systemic inflammation (Fig 1 a); significantly decreased serum 95 
albumin (Fig 1b) and hemoglobin (Fig 1c) levels, indicating viral-induced anemia; and 96 
progressively increasing  total serum CO 2 levels (Fig S1 a) indicative of pulmonary dysfunction. 97 
These observations were accompanied by a decrease in red blood cells (RBCs) (Fig S1b), 98 
reticulocytes (Fig S1 c), white blood cells (WBCs) (Fig S1d), and platelet counts (Fig S1e); and a 99 
decrease in both the total number and percentage of neutrophils (Fig S1f, g), the latter suggesting  100 
that neutrophils are recruited to the lung  compartment in response to SARS-CoV-2 infection as 101 
first responders. In contrast, systemic influx of monocytes was observed, indicating viral 102 
infection-induced myelopoiesis (Fig S1 h). Monocytes are crucial for successful antiviral responses 103 
via recognition of pathogen-associated molecular patterns, thereby initiating a signaling cascade 104 
that invokes an interferon response to control infections. No significant pyrexia or weight  loss 105 
was observed in this acute study. Overall, our results suggest that rhesus macaques develop 106 
several clinical signs of viral infection following experimental exposure to SARS-CoV-2.  107 
 108 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148832
Viral RNA was detected in BAL, and from nasal or nasopharyngeal (NS) and buccopharyngeal (BS) 109 
swabs at 1-3 days post-infection (dpi), but not at pre-infection time points (Fig 1d-f). Vir al RNA 110 
was also detected in saliva and from rectal swabs (RS) in a small subset of animals (Fig S 1i-j). 111 
Unlike other samples, viral RNA was only detected in RS at later time points (i.e., after 1 dpi). At 112 
necropsy (3 dpi), we performed random sampling from every lung lobe and SARS-CoV-2 RNA 113 
could be detected in 23/24 total lung sections analyzed. An average of 4-6 log copies/100 mg of 114 
lung tissue could be detected from every lobe  (Fig 1g) . The ~4-log increase in viral RNA from 1 to 115 
2 dpi in the BAL (Fig 1d) provided clear evidence of early active replication of SARS-CoV-2 in 116 
rhesus macaques.  117 
 118 
Examination at necropsy (3 dpi) revealed findings of interstitial and alveolar pneumonia (Fig 1h, 119 
i). While gross appearance of the lungs of most infected animals was unremarkable (Fig S2a), 120 
multifocal to coalescing red discoloration of the left lung lobes in one macaque was observed (Fig 121 
S2b). Table S2 summarizes the histopathologic findings in descending order of occurrence by 122 
anatomic location. The lung was the most affected organ ((Fig 1h, i, Table S2, Fig S2). Multifocal, 123 
mild to moderate interstitial pneumonia characterized by infiltrates of neutrophils, macrophages, 124 
lymphocytes, and eosinophils was present in all four animals (Fig 1 i, Fig S2d, e, g, h), and was 125 
accompanied by variable fibrosis (4/4, Fig S2e), fibrin deposition (3/4, Fig S2c), vasculitis (3/4, Fig 126 
S2f), edema (2/4, Fig S2h), necrosis (Fig S2g), and areas of consolidation (2/4, Fig S2c). All four 127 
macaques exhibited the following: 1) Syncytial cells in the epithelial lining and/or alveolar lumen 128 
(Fig S2e, g, k) ; 2) Bronchitis characterized by infiltrates of eosinophils within the bronchial wall 129 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148833
and epithelium (Fig 1h, Fig S2i, j, k); Bronchus -associated lymphoid tissue (BALT) hyperplasia (Fig 130 
S2i); and 4) Minimal to moderate lymphoplasmacytic and eosinophilic tracheitis and rhinitis. 131 
 132 
The presence of SARS-CoV-2 in tissue sections collected at necropsy (3 dpi) was determined by 133 
multi-label confocal immunofluorescence using antibodies specific for Nucleocapsid (N) (Fig 1j, 134 
k, Fig S3) and Spike (S) proteins (Fig S4) and their respective isotype controls (Fig S3, S4). 135 
Fluorescence immuno-histochemical analysis revealed the presence of SARS CoV-2 proteins in 136 
lungs (Fig 1j, Fig S3a, g, Fig S4a, d, g, j), nasal epithelium (Fig 1k, Fig S3b, h, Fig S4b, e, h, k) and 137 
tonsils (Fig S3c, i, Fig S4c, f, I, l). In all tissues, including lungs (Fig 1j, Fig S3 a, g), nasal epithelium 138 
(Fig 1k, Fig S3 b, h) and tonsils (Fig S3 c, i), N antigen signal was present in cells expressing ACE2, 139 
which has been shown to be a receptor for SARS-CoV-2, or in cells adjoining those expressing 140 
ACE2. No signal was detected in N isotype control staining in lungs, nasal epithelium or tonsils 141 
(Fig S3d -f), and no signal for viral antigen was detected in naïve tissues (Fig S3 m, n). It appeared 142 
that the expression levels of ACE2 protein w ere much lower in lung tissues derived from naïve 143 
animals compared to those  from macaques exposed to SARS-CoV-2 (Fig S3 m, n).  The majority of 144 
the S signal was detected in the epithelial layer with discrete distribution throughout the lung 145 
tissue (Fig S4a, d). In the nasal cavity, the virus was observed in cells of the epithelial linings (Fig 146 
S4b, h) but in tonsils, the virus appeared distributed throughout the tissue (Fig 3c, i). Together, 147 
these results show that SARS-CoV-2 exposure induces a respiratory tract infection in rhesus 148 
macaques. Viral replication is supported in the upper and lower lung compartments during the 149 
first three days of infection and viral antigens are detected at high levels in the lungs. 150 
 151 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148834
To complement the lung histopathology in rhesus macaques, radiographs were performed at 152 
baseline and each day post -infection. All four infected macaques showed progressi ve increase in 153 
CXR abnormality scores, consistent with an infectious disease (Fig 2a, Fig S5a). The 2 and 3 dpi 154 
CXR scores were significantly elevated relative to baseline (Fig 2a), despite evidence of partial 155 
resolution of specific lesions at 2 or 3 dpi versus 1 dpi (Fig S5a). There were  mild-to-severe 156 
multifocal interstitial-to-alveolar patterns with soft tissue opacities (seen as ground glass 157 
opacities described in the CT scans below) in various lobes or diffusely in some animals, with 158 
more severe abnormalities in the lower lung lobes, and with the most severe findings at 3 dpi 159 
(Fig S 5a). Pleural effusions were also observed.  160 
 161 
Lung CT scans prior to infection showed  a normal thorax cavity with the exception of atelectasis 162 
(Fig 2b -d, top panel). Within 1 dpi, CT scans showed increased multifocal pulmonary infiltrates 163 
with ground glass opacities in various lung lobes, linear opacities in the lung parenchyma, nodular 164 
opacities in some lung lobes, and increased soft tissue attenuation extending primarily adjacent 165 
to the vasculature (Fig 2c, Fig S 5b-e). In some animals, multifocal alveolar pulmonary patterns 166 
and interstitial opacities were observed in lobe subsections, with soft tissue attenuation and focal 167 
border effacement with the pulmonary vasculature. Features intensified at 2-3 dpi, primarily in 168 
the lung periphery, but also adjacent to the primary bronchus and the vasculature (Fig 2d , Fig 169 
S5b). In other animals, progressive alveolar or interstitial pulmonary patterns were observed at 170 
2 dpi (Fig 2c). While ground glass opacities in some lobes intensified at 2 dpi relative to 1 dpi, 171 
others resolved (Fig S5c, d). In one animal, the individual nodular pattern at 1 dpi evolved to a 172 
multifocal soft tissue nodular pattern in multiple lobes with associated diffuse ground glass 173 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148835
opacities (Fig S 5d). At 3 dpi, persistent, patchy, fairly diffuse ground glass pulmonary opacities 174 
existed in many lung lobes with multifocal nodular tendency (Fig S 5e). Overall, CT abnormality 175 
scores continuously increased at over the 3 days relative to baseline (Fig 2e). Percent change in 176 
the hyperdensity volume was calculated using CT scans to quantify pathological changes over the 177 
course of disease 8. We  observed a significant increase in lung hyperdense areas between 1-3 dpi 178 
compared to the baseline scans (Fig 2f-i). Measurement of volume involved in hyperdensity 179 
showed a significant, progressive increase over time (Fig 2j). Pneumonia was evident in all 180 
infected animals relative to their baseline (Fig 2j), suggesting  that while some lesions formed and 181 
resolved within the three-day infection protocol, others persisted or progressed.  Together, CXR 182 
and CT scans revealed moderate multi-lobe pneumonia in infected animals, confirming the 183 
histopathology results (Fig 1h, i, Fig S2)  in the very early phase of SARS-CoV-2 infection in rhesus 184 
macaques. 185 
 186 
We measured the levels of pro-inflammatory, Type I cytokines in the BAL fluid (Fig 3) and plasma 187 
(Fig S 6a-l) of acutely infected rhesus macaques. Levels of IL-6 (Fig 3a), IFN-a (Fig 3b), IFN-g (Fig 188 
3c), IL-8 (Fig 3d), perforin (Fig 3e), IP-10 (Fig 3f), MIP1-a (Fig 3g) and MIP1-b (Fig 3h) were all 189 
significantly elevated in the BAL fluid. The levels of IL-12p40 (Fig 3i), IL-18 (Fig 3j), TNF (Fig 3k) 190 
and IL-1Ra (Fig 3l) increased over time. Of particular interest was the elevation of Type I IFN-a 191 
(Fig 3b), which has critical anti-viral activity including against SARS-CoV-2 9. Expression of a 192 
downstream Type-I interferon-regulated gene IP-10 (CXCL-10), which promotes the recruitment 193 
of CXCR3+ Th1 thymocytes, was also induced (Fig 3f). Therefore, we observed  that rhesus 194 
macaques mount an early anti-viral response to SARS-CoV-2 infection. Type I IFNs and IL-6 (both 195 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148836
significantly expressed) are key compon ents of a “cytokine-storm” which promote acute 196 
respiratory distress syndrome (ARDS) associated with both SARS-CoV-1 and -2, when induced 197 
uncontrollably10. IFN-a and IP-10 were  also significantly elevated in plasma samples at 2 and 3 198 
dpi (Fig S6). 199 
 200 
Thus, clinical, imaging, pathology and cytokine analyses provide evidence for an acute infection 201 
in macaques following exposure to SARS-CoV-2, which leads to a moderate pneumonia and 202 
pathology, with early activation of anti-viral responses. To study progression of infection, and 203 
assess the effect of age on SARS-CoV-2 infection, we inf ected six young and six old Indian-origin 204 
rhesus macaques as described above and longitudinally followed the outcome over 14-17 days 205 
(Table S1). We included four macaques as procedural controls, which were sham-infected and 206 
underwent all procedures (with the exception of necropsy) to control for the impact of multiple 207 
procedures over the course of the study (Table S1). We also infected six baboons and an equal 208 
number of marmosets with SARS-CoV-2 in order to compare the progression of COVID-19 in 209 
different NHP models. 210 
 211 
Long-term study of SARS-CoV-2 infection in rhesus macaques, baboons and marmosets 212 
demonstrates heterogeneity in progression to COVID -19  213 
Results of the longitudinal study showed that the acute signs of SARS-CoV-2 infection and mild- 214 
to-moderate COVID-19 disease in rhesus macaques markedly improved over time (Fig S7). In 215 
general, no major differences were observed as a consequence of age, and subsequent data from 216 
young and old animals are combined (N=12), unless specified. A small subset (3/12) of animals 217 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148837
exhibited elevated serum CRP past 3 dpi (Fig S7a), although metabolic signs of dysfunction likely 218 
induced by infection (e.g. tCO2 elevation) continued for the duration of the study (Fig S 7b). No 219 
alterations were observed in the levels of serum albumin or hemoglobin  during this timeframe 220 
(not shown). There was a significant decline in RBCs (Fig S7c) at 3 and 6 dpi which normalized or 221 
reverted by 9 dpi. The percentage of neutrophils in the peripheral blood remained unchanged 222 
between 3-14 dpi (not shown). The significant decline in blood platelets and increase in the 223 
percentage of monocytes observed at 3 dpi, were short-lived (Fig S7d, e). Despite these modest 224 
changes, the majority of animals in both age groups exhibited weight loss throughout the study 225 
duration (Fig S7f), although pyrexia was not observed (not shown).  226 
 227 
Viral RNA was detected in BAL of 10/12 macaques at 3 dpi, but declined thereafter (Fig 4a). 228 
Detection of viral RNA was equivalent between young (5/6) and old (5/6) macaques (Fig S8a). 229 
Very low viral RNA copy numbers were detected in BAL at 9 dpi with only one young macaque 230 
testing positive, and none by 12 dpi (Fig 4a). Viral RNA appeared to persist for much longer in NS 231 
than BAL, including at study endpoint (Fig 4b). Viral RNA was detected from NS in 6/12 macaques 232 
at 3 dpi and on average young macaques harbored more virus in their nasal cavity at 3 dpi relative 233 
to old animals but the differences were not significant (Fig S8b). SARS-CoV-2 RNA was detected 234 
in 10/12 macaques (6 young, 4 old, respectively) at 9 dpi and 6/12 macaques at the end of the 235 
study period (Fig S 8b). These results suggest that the virus persists for at least two weeks in the 236 
respiratory compartment of immunocompetent macaques that clinically  recovered  from COVID- 237 
19. Viral RNA was detected from BS in 4/12 animals at 3 and 6 dpi, but not at later time points 238 
(Fig S8c, d). No significant difference was detected between age groups. Viral RNA was also 239 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148838
detected from RS in 2/12 animals at 3, 6 and 9 dpi (Fig S8e, f). Significantly lower levels of viral 240 
RNA (2.5 logs) were detectable at the end of the study (14-17 days) when c ompared to viral RNA 241 
detected at the end of the 3-day protocol (Fig 4c, Fig S9a). Viral RNA was detected in the lungs of 242 
two-thirds (8/12) of all macaques and no effect of age was apparent. No viral RNA was detected 243 
in any serum samples (Fig S9b) or in randomly selected urine samples (Fig S9c).  The presence of 244 
viral RNA in the lungs of macaques after two weeks following recovery from acute COVID-19 245 
indicates that while macaques control SARS-CoV-2 infection, immune responses are not 246 
sterilizing.  247 
 248 
Gross examination of the lungs of most infected animals at necropsy (14 to 17 dpi) was 249 
unremarkable (Fig S10a); however, red discoloration of the dorsal aspect of the lung lobes was 250 
seen in four young and two aged animals (Fig S10b). Table S3 summarizes the histopathologic 251 
findings  in descending order of occurrence by anatomic location. The lungs were the most 252 
affected organ (Fig 4d, e, Table S3). Multifocal minimal to mild interstitial mononuclear 253 
inflammation was seen in 11/12 animals (Fig 4n, 0, Fig S 10c), generally composed of macrophages 254 
and lymphocytes that expanded the alveolar septa (Fig 4n, Fig S10d, e, f, g), with variable 255 
neutrophil infiltrates (5/12, Fig S10e), fibrosis (5/12, Fig 4o, Fig S 10f, g) or vasculitis (3/12, Fig 256 
S10i). Alveolar epithelium often contained areas of type II pneumocyte hyperplasia (4/12, Fig 257 
S10e) and bronchiolization (2/12, Fig S 10h). Alveolar lumina contained increased alveolar 258 
histiocytosis (9/12, Fig 4o, Fig S 10d, e) occasionally admixed with neutrophils (5/12, Fig S10e). 259 
Syncytial cells (Fig S10e, f) were observed most frequently in the alveolar lumen in all 12 animals. 260 
Bronchitis was observed in 4/12, characterized by infiltrates of eosinophils within the bronchial 261 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148839
wall and epithelium (Fig S10j). Prominent perivascular lymphocytes (7/12, Fig S10k) and BALT 262 
hyperplasia (5/12, Fig S 10i) were frequently observed. The majority of the animals (11/12) 263 
exhibited minimal to moderate lymphoplasmacytic and eosinophilic tracheitis.  264 
 265 
Early detection of viral RNA in BAL was comparable between macaques and baboons (Fig 4a, f) 266 
and NS (Fig 4b, g). A third of the baboons had detectable viral RNA in NS at 12 dpi (Fig 4g), and a 267 
similar number of animals remained positive at 9 dpi in the BS (Fig S11a). The number of baboons 268 
from which viral RNA could be detected in RS increased over time from 1/6 at 3 dpi to 3/6 at 6 269 
dpi, 4/6 at 9 dpi and 3/6 at 12 dpi, underscoring long-term viral persistence of SARS-CoV-2 in 270 
baboons relative to rhesus macaques (Fig S1 1b).  Postmortem gross examination at 14 to 17 dpi 271 
identified red discoloration of the lung lobes in all six baboons (Fig S11c, d). Table S4 summarizes 272 
the histopathologic findings  in descending order of occurrence by anatomic location. Like 273 
macaques, the lungs were the most affected organ in the baboons (Fig 4h, i, Table S6, Fig S11). 274 
Multifocal minimal to moderate interstitial mononuclear inflammation was seen in 6/6 animals 275 
(Fig 4h, Fig S11f, g, h, i), generally composed of macrophages and lymphocytes that expanded 276 
the alveolar septa, with variable neutrophil infiltrates (3/6, Fig S11f, g, j, k) or fibrosis (2/6, Fig 277 
S11j, k). Alveolar epithelium often contained areas of type II pneumocyte hyperplasia (4/6, Fig 4i, 278 
Fig S1 1i) and bronchiolization (1/6, Fig S1 1l). Alveolar lumina contained increased alveolar 279 
histiocytosis (6/6, Fig 4h) occasionally admixed with neutrophils (3/6) (Fig S11f, g, h, i). Syncytial 280 
cells were observed most frequently in the alveolar lumen in all 6 animals (Fig 4h, Fig S1 1m). 281 
Bronchitis was observed in 6/6, characterized by infiltrates of eosinophils within the bronchial 282 
wall and epithelium (Fig S11n). BALT hyperplasia (5/6, Fig S11k) was frequently observed. The 283 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148840
majority of the animals exhibited minimal to moderate lymphoplasmacytic and eosinophilic 284 
tracheitis (5/6) and rhinitis (4/6).   285 
 286 
SARS-CoV-2 infection was milder in marmosets. Less than 4 logs of viral RNA could be  detected 287 
in NS from infected marmosets, peaking at 3 dpi, and 1/6 animals was also positive at 6 dpi. N o 288 
viral RNA was detected at later time points (Fig 4j). No viral RNA was detected in BS (Fig 4k). A 289 
subset of six marmosets was euthanized at 3 dpi (n=2), while others were necropsied at 14 dpi. 290 
Approximately 2 logs of viral RNA could be detected in the lungs of marmosets at both time 291 
points. Evidence of SARS-CoV-2 infection-induced pathology, including interstitial and alveolar 292 
pneumonitis was observed in marmoset lungs as well (Fig 4m, n), although not as prevalent as in 293 
macaques or baboons. Thus, our results show that three genera of NHPs develop different 294 
degrees  of COVID-19 following SARS-CoV-2 infection when evaluated side by side, with baboons 295 
exhibiting moderate to severe pathology, macaques exhibiting moderate pathology and 296 
marmosets exhibiting mild pathology. Viral RNA levels in BAL, NS and lungs are consistent with 297 
the levels of pathology. While other results also suggest that marmosets are unaffected by SARS- 298 
CoV-2 infection 4 (https://www.biorxiv.org/content/10.1101/2020.03.21.001628v1 ), we show 299 
that these NHPs do de velop non-negligible, mild COVID-19-related pathology and some degree 300 
of viral persistence.  301 
 302 
We performed detailed imaging of macaques in the longitudinal study. Similar to the acute study, 303 
imaging revealed the development of viral pneumonia. All macaques infected with SARS-CoV-2 304 
exhibited low baseline CXR scores (Fig 5a,  Table S5) with no difference due to age (Fig 5b). Several 305 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148841
infected macaques showed changes consistent with pneumonia (Table S5) with peak severity 306 
seen between 3-6 dpi, followed by a decline by study end (Fig 5a, b, Table S5). Examples of the 307 
development of extensive pneumonia by CXR can be seen in macaques at 6 dpi, relative to 308 
baseline with subsequent resolution (Fig 5 c-e). Several animals exhibited multi-lobe alveolar 309 
infiltrates and/or interstitial opacities at 6 dpi. In other animals, there were progressive, 310 
mode rate to severe interstitial and alveolar infiltrates at 6 dpi, which resolved by day 14. 311 
Conversely, the radiographs of all procedure control animals (which underwent repeated BAL 312 
procedures) exhibited normal a thorax cavity with minimal to no findings.  313 
 314 
High resolution CT imaging of the lungs was performed prior to and following SARS-CoV-2 315 
infection on six young and six old macaques. Pneumonia was present in all animals, post - 316 
infection, but to a significantly higher degree in old macaques relative to young (Fig 5f, Fig S1 2a- 317 
f, Table S6). At 6 dpi, severe patchy alveolar patterns were observed in some lobes, while other 318 
lobes had milder, interstitial patterns, with moderate to severe ground glass opacities primarily 319 
in the lungs of old macaques (Fig S12a-f). In all animals, resolution of many ground glass opacities 320 
and nodular as well as multifocal lesions was observed at 12 dpi (Fig 5f, Fig S12a, b, d-f). At 12 321 
dpi, all but one of the older macaques exhibited a normal or nearly normal thorax cavity, the 322 
latter with minimal ground glass opacities in all lung lobes studied at this time . Findings in one 323 
older macaque was considerably improved but retained patchy round glass opacities in all lobes 324 
and alveolar patterns in some lobes at 12 dpi (Fig S1 2c). This animal had the highest overall score 325 
by CT (Fig 5f) and CXRs (Fig 5 a-b). These results suggest that pneumonia in some older macaques 326 
may persist longer than in younger animals. Similar to the acute study, hyperdensity analysis 327 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148842
revealed a significant, progressive increase in the volume of lung involved in pneumonia at 6 dpi, 328 
which normalized by 12 dpi (Fig 5g-o). 329 
 330 
SARS-CoV-2 infection in macaques results in a dynamic myeloid cell response in the lungs  of 331 
rhesus macaques 332 
Cellular composition in BAL samples and peripheral blood11,12 at necropsy showed markedly 333 
altered immune cell responses in the lung compartment following infection of macaques. In 334 
healthy lungs, BAL is predominantly comprised of alveolar macrophages (AMs)13 but respiratory 335 
tract infections result in the influx of other immune cells. SARS-CoV-2 infection moderately 336 
increased the proportions of myeloid cells in the BAL 3 dpi, with most returning to normal by 9 337 
dpi (Fig S1 3a). There was no effect of age (Fig S 13b). The myeloid influx  included cells phenotyped 338 
as interstitial macrophages (IMs, Fig 6a, e), neutrophils (Fig 6c, g) and plasmacytoid dendritic cells 339 
(pDCs, Fig 6d, h). In contrast, the levels of resident AMs in BAL declined significantly at 3 dpi (Fig 340 
6b, f). The increase in IMs, neutrophils and pDCs at 3 dpi was highly correlated with the levels of 341 
viral RNA (Fig 6i-j, Fig S13i), while AMs exhibited an opposite trend. The frequency of 342 
conventional dendritic cells (cDCs) declined as pDCs increased in BAL (Fig S1 3c). An increase in 343 
the levels of both classical (CD14+CD16-) (not shown) and intermediate/inflammatory 344 
(CD14+CD16+) monocytes in BAL was also observed at 3 dpi (Fig S13d). The frequency of myeloid 345 
subpopulations increased in BAL was generally reduced in blood (Fig S13e-h), with two 346 
exceptions - pDCs and CD14+CD16+ monocytes, which were increased in the blood as well as BAL 347 
(Fig S1 3g-h). Relative to AMs, IMs have a shorter half-life, exhibit continuous turnover, and may 348 
help to maintain homeostasis and protect against continuous pathogen exposure from the 349 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148843
environment14. Increased recruitment of pDCs to the lungs suggests a potentially important 350 
feature of protection from advanced COVID-19 disease in the rhesus macaque model since they 351 
are a major source of anti-viral Type I interferons such as IFN-a, the levels of which were elevated 352 
in the BAL within 1-3 dpi (Fig 3 b).  353 
 354 
Multi-label confocal imaging of lung tissues following Ki67 staining depicted that only few of the 355 
virally-infected cells in the lung tissue actively proliferated  (Fig 5k-p). Detailed analysis of the lung 356 
tissue revealed that neutrophils (Fig 6 k, l, Fig S14a, d), macrophages (Fig 6 m, n , Fig S14b, h) and 357 
pDCs  (Fig 6 o, p, Fig S1 4c, i) recruited to the lung compartment (Fig 6a-h) harbored high levels of  358 
viral proteins (Fig 6k-p, Fig S14). Apart from these, many of the other cell-types contained viral 359 
proteins, suggesting a capacity of the virus to infect many cell types and that intact virus may also 360 
persist in the lungs. These novel data suggest that rapid influx of specialized subsets of myeloid 361 
cells to the lung that are known to express Type I IFNs and other pro-inflammatory cytokines is a 362 
key event in the control of SARS-CoV-2 infection. 363 
 364 
Infection of macaques also resulted in a significant influx of T cells to the alveolar space by 3 dpi, 365 
which normalized by 9 dpi (Fig 7a, b, g). After infection, CD4+ T cells expressed significantly lower 366 
levels of antigen-experience/tissue residence (CD69 ; Fig 6c), Th1 (CXCR3; Fig 6d), memory (CCR7; 367 
Fig 6f), and activation (HLA-DR) (Fig 6m) markers in BAL. In contrast, the levels of CD4+ T cells 368 
expressing PD -1 (Fig 6e) and LAG-3 (Fig 6n) were significantly elevated, while those of CD4+ T cells 369 
expressing CCR5 (Fig 6l) were unchanged. A similar effect was observed in CD8+ T cell subsets, 370 
where the expression of CD69 (Fig 6h), CXCR3 (Fig 6i), and CCR7 (Fig 6k) was significantly reduced 371 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148844
in BAL following infection whereas expression of PD -1 (Fig 6j) and LAG-3 (Fig 6q) in the CD8+ T 372 
cells was significantly increased. CCR5 (Fig 6o) and HLA-DR (Fig 6p) were unchanged. No 373 
differences were observed in T cell responses in young relative to old animals. Taking data from 374 
myeloid cells and lymphocytes together, we postulate that the rapid influx of myeloid cells 375 
capable of producing high levels of Type I IFNs result in immune control of SARS-CoV-2 infection 376 
in macaques, but that this control is not sterilizing. This allows for viral antigens to persist leading 377 
T cell recruitment, but with a T cell profile associated with immune modulation and promotion 378 
of antigen-mediated T cell anergy/exhaustion (PD-1, LAG3 expression)15.  379 
 380 
To extrapolate from phenotype to function, we explored proliferation, immune mediator 381 
production, and memory phenotypes. CD4+ and CD8+ T cells e xhibit ing proliferative (Fig 8a, g) 382 
and memory markers (Fig 8b, h) were significantly increased in BAL after infection whereas CD4+ 383 
and CD8+ T cells expressing naïve (Fig 8c, i) and effector (Fig 8d, j) phenotypes were significantly 384 
reduced. The percentage of CD4+ (Fig 8e) and CD8+ (Fig 8k) T cells expressing IL-2 was significantly 385 
elevated in the BAL at 9 dpi. A similar effect was observed for Granzyme-B (GZMB) (Fig 8f, l) which 386 
was sustained through 9 dpi. No significant effect of age was observed, although the expression 387 
of IL-2 on T cells was higher for young compared old rhesus macaques. Frequencies of CD4+ and 388 
CD8+ expressing interferon-g (IFNG) (Fig S1 5a, d) and IL-17 (Fig S15b, e) were elevated, but 389 
unchanged for TNF-a (Fig S 15c, f). Greater expression of IFNg was measured on CD4+ T cells 390 
recruited to the BAL in younger animals, but the differences were not statistically significant. 391 
These results suggest that robust cellular immune responses (both CD4+ and CD8+ T cells) are 392 
generated in the lung compartment (BAL) as early as day 3 and maintained at 9 dpi in many 393 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148845
instances. Following e x vivo re-stimulation of T cells from BAL at 9 dpi with CoV-specific peptide 394 
pools, CD4+ T cells expressing IL-2 (Fig 8m), GZMB (Fig 8n), IFN-g (Fig S1 5g), IL-17 (Fig S15h) and 395 
TNF-a (Fig S1 5i) were not statistically elevated beyond baseline values. This was similar for CD8+ 396 
T cells expressing IL-2 (Fig 8o), GZMB (Fig 8p), IFN-g (Fig S1 5j), IL-17 (Fig S15k) and TNF-a (Fig 397 
S15l). In combination with increased expression of the immune-regulatory markers PD-1 and 398 
LAG-3, our results suggest that T cells recruited to the lung compartment following SARS-CoV-2 399 
infection are capable of secreting cytokine but fail to generate robust antigen specific responses 400 
highlighting the fact that persist ent T cell stimulation by viral antigens may generate T cell anergy 401 
relatively early in infection and this is promoted by our findings of viral persistence in the 402 
respiratory tract.  403 
 404 
Immunophenotyping results were confirmed by studying cytokine production in BAL and plasma 405 
(Fig S1 6)16. Our results show that the levels of IFN-a (Fig S1 6a), IL-1Ra (Fig S1 6b), and IL-6 (Fig 406 
S16d) were elevated in BAL following infection, but levels rapidly normalized after the 3 dpi peak . 407 
Levels of IFN-a were also induced in plasma (Fig S16g), but not those of IL-1Ra (Fig S16h), and IL- 408 
6 (Fig S1 6j) or other cytokines studied. Cytokines were not induced at baseline or in procedure 409 
control animals. Overall, the longitudinal study results were consistent with the acute infection 410 
study in the expression of Type I pro-inflammatory cytokines responsible for viral control (IFN-a) 411 
and expression of IL-6, which may contribute to a cytokine storm and development of ARDS in a 412 
subset of hosts during COVID-19.  413 
 414 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148846
Protein levels of ACE-2, one presumed receptor for SARS-CoV-2 in humans, were detected at 415 
higher levels in the lungs and nasal epithelia of infected macaques than those in the lungs of 416 
naive rhesus macaques (Fig 1j, k). Using RNAseq we also studied if expression of ACE-2 could be 417 
detected in macaque lung tissues and elevated in in SARS-CoV-2 infected animals. This was 418 
indeed the case (Fig S17a-d) in a statistically significant manner two weeks after infection despite 419 
multiple hypothesis correction (Fig S17a, b). Interestingly, ACE-2 expression was significantly 420 
higher in young compared to old macaques (Fig S17c, d). These results potentially explain the 421 
higher levels of virus that we observed in several samples derived from young macaques in these 422 
two cohorts (Fig S8). Expression of transcripts specific for other viral receptors/co-receptors e.g., 423 
Cathepsin-L,  CD147 or TMPRSS2 was not significantly altered in the lung two weeks after 424 
infection (Fig S17a). 425 
 426 
Altogether, our results show that rhesus macaques, baboons and marmosets can all be infected 427 
with SARS-CoV-2 but exhibit differential progression to COVID-19. While marmosets exhibit mild 428 
infection, macaques are characterized by the presence of moderate progressive pneumonia that 429 
is rapidly resolved. This is accompanied by a marked reduction in lung and nasal viral loads. 430 
Baboons appear to have the most lung pathology, and the level of viral shedding and persistence 431 
in extra-respiratory compartment is also greater in this model. Furthermore, we show the 432 
importance of state-of-the-art, non-invasive imaging – cone beam CT scanning, and the 433 
application of innovative algorithms to identify the extent of lung involved in pneumonia, in 434 
developing models of COVID-19. This provided us with a quantifiable metric that lent itself to 435 
accurately assessing the efficacy of vaccines or the impact of therapeutic interventions.  436 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148847
 437 
Our results also point out, for the first time, that SARS-CoV-2 infection is associated with dynamic 438 
influxes of  specific subsets of myeloid cells  to the lung, particularly IMs, neutrophils and pDCs, 439 
and that viral proteins can be detected in these cells . These  cellular influxes  are likely due to a 440 
strong viral-induced myelopoeisis. This may help explain both development of COVID-19 441 
pneumonia and subsequent control via expression of a strong Type I IFN response and expression 442 
of other pro-inflammatory cytokines. We speculate that these responses clear the majority of 443 
virus, and, in doing so , lead to eventual resolution of pneumonia, while limiting a progressive 444 
cytokine storm and ARDS in the majority of hosts. Macaques have served as excellent models of 445 
infectious diseases and vaccine development efforts17-19, and this model permits lung imaging 446 
and detailed immune evaluations. Given the ability to reproducibly measure viral loads in NS and 447 
BAL, and quantify lung involvement by CT scans and hyperdensity analyses, we expect this model 448 
to play a critical role in the preclinical testing of novel candidate vaccines against SARS-CoV-2 449 
infection and/or COVID-19 disease in development . Experiments in rhesus macaques can also 450 
evaluate safety and immunogenicity, including the important issue of antibody-mediated 451 
immune enhancement. Since mild-to-moderate COVID-19 disease that follows SARS-CoV-2 452 
infection in rhesus macaques is short-lived, it follows that vaccine safety and efficacy studies can 453 
be evaluated in short term studies. 454 
 455 
However, detection of both virus and its protein antigens over two weeks in macaques, baboons 456 
and even marmosets, indicates viral persistence rather than sterilizing immunity . Support for this 457 
comes from the finding of PD-1 and LAG-3 expression by CD4+ and CD8+ T cells in the lung and 458 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148848
lack of induction of antigen-specific immune effector cytokine production by these cells. 459 
Characterization of these responses is particularly important considering that T cell responses, 460 
particularly T helper responses, play key roles in shaping the nature of downstream B cell 461 
responses and production of antibodies. It is likely that in immunocompromised patients, 462 
persistent presence of SARS-CoV-2 could lead to exacerbated disease. Since COVID-19 has 463 
disproportionately affected the aging human population, we included age as an independent 464 
variable in our studies. Although there were several smaller changes observed in older animals, 465 
old and young animals both resolved infection. While it is possible that NHPs do not completely 466 
model all aspects of COVID-19 in humans, these findings suggest that underlying conditions which 467 
impact immunity such as defined and undefined co-morbidities, rather than aging per se, may be 468 
responsi ble for the greater morbidity and mortality observed due to COVID-19 in the aged human 469 
population (and a subset of younger individuals). Baboons developed  more extensive disease and 470 
pathology with more widespread and severe inflammatory lesions compared to rhesus 471 
macaques. Baboons are also a preferred model of cardiovascular and metabolic diseases 472 
including diabetes 20-22, and therefore further development of the baboon model may prove 473 
especially useful for the study of co-morbidities with COVID-19 such as diabetes, cardiovascular 474 
disease, and aging. 475 
 476 
Methods 477 
 478 
Study approval. All of the infected animals were housed in Animal Biosafety Level 3 or 4 (ABSL3, 479 
ABSL4) at the Southwest National Primate Research Center where they were treated per the 480 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148849
standards recommended by AAALAC  International and the NIH Guide for the Care and Use of 481 
Laboratory Animals. Sham controls were housed in ABSL2. The animal studies in each of the 482 
species  were approved by the Animal Care and Use Committee of the Texas Biomedical Research 483 
Institute and as an omnibus Biosafety Committee protocol. 484 
 485 
Animal studies and clinical evaluations. 16 (eight young  and eight young , see Table S1 for details) 486 
Indian-origin rhesus macaques (Macaca mulatta), and six African-origin baboons (Papio 487 
hamadryas) all from SNPRC breeding colonies, were exposed  via multiple routes (ocular, 100 µL; 488 
intranasal, 200 µL - using a Teleflex Intranasal Mucosal Atomization Device; intratracheal, 200 µL 489 
- using a Teleflex Laryngo-Tracheal Mucosal Atomization Device) of inoculation to 500 µL of an 490 
undiluted stock of SARS-CoV-2, which had a titer of 2.1E+06 pfu/mL, resulting in the 491 
administration of 1.05x106 pfu SARS-CoV-2. SARS-CoV-2 generated from isolate USA-WA1/2020 492 
was used for animal exposures.  A fourth cell-culture passage (P4) of SARS-CoV-2 was obtained 493 
from Biodefense and Emerging Infections Research Resources Repository (BEI Resources, catalog 494 
number NR-52281, GenBank accession number MN985325.1) and propagated at Texas Biomed. 495 
The stock virus was passaged for a fifth time in Vero E6 cells at a multiplicity of infection (MOI) 496 
of approximately 0.001. This master stock was used to generate a sixth cell culture passage 497 
exposure stock by infecting VeroE6 cells at a MOI of 0.02. The resulting stock had a titer of 2.10 498 
x 106 PFU/mL and was attributed the Lot No. 20200320. The exposure stock has been confirmed 499 
to be SARS-CoV-2 by deep sequencing and was identical to published sequence (MN985325).  500 
strain USA-WA1/2020 (BEI Resources, NR-52281, Manassas, VA). Six Brazilian-origin common 501 
marmosets (Callithrix jacchus) were also infected via the combined routes (80µL intranasal; 40µL 502 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148850
ocular [20µL/eye]; 40µL oral performed twice for a total of 160µL intranasal, 80µL ocular; 80µL 503 
oral and 100µL IT) of the same stock. The total target dose presented to marmosets was 8.82E+05 504 
pfu/mL. Four macaques, baboons and marmosets each were sham-infected with DMEM-10 505 
media (the storage vehicle of the virus), to be used as procedural controls. Infected animals were 506 
euthanized for tissue collection at necropsy, and control animals were returned to the colony. 507 
Macaques were enrolled from a specific pathogen-free colony maintained at the SNPRC and were 508 
tested free from SPF-4 (simian retrovirus D, SIV, STLV-1 and herpes B virus). All animals including 509 
the baboons and the marmosets were also free of Mycobacterium tuberculosis. Animals were 510 
monitored regularly by a board-certified veterinary clinician for rectal body temperature, weight 511 
and physical examination. Collection of blood, BAL, nasal swab, and urine, under tiletamine- 512 
zolazepam (Telazol) anesthesia was performed as described (Table S1), except that BAL was not 513 
performed in marmosets. Four macaques were sampled daily until euthanized at 3dpi. All other 514 
macaques and all the baboons were sampled at 0, 3, 6, 9, 12 dpi and at euthanasia (BAL 515 
performed weekly). Blood was collected for complete blood cell analysis and specialized serum 516 
chemistries. Animals were observed  daily to record alert clinical measurements. Nasal 517 
(longitudinal) or nasopharyngeal (acute) swabs and BALs were obtained to measure viral loads in 518 
a longitudinal manner , as described earlier 11. Briefly, in a sitting position, the larynx was 519 
visualized and a sterile feeding tube inserted into the trachea and advanced until met with 520 
resistance. Up to 80ml of warm sterile saline was instilled, divided into multiple aliquots. Fluid 521 
was aspirated and collected for analysis.  522 
Chest X-Rays. Clinical radiographic evaluation was performed as following: The lungs of all 523 
animals were imaged by conventional (chest radiography, CXR), as previously described 23. Three 524 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148851
view thoracic radiographs (ventrodorsal, right and left lateral) were performed at all sampling 525 
time points. High-resolution computed tomography (CT) was performed daily through 3 dpi in 4 526 
infected macaques and on 6 and 12 dpi in 3 young and 3 old macaques as described in the next 527 
section. Images were evaluated by a board-certified veterinary radiologist and scored as normal, 528 
mild moderate or severe disease. The changes were characterized as to location (lung lobe) and 529 
distribution (perivascular/peribronchial, hilar, peripheral, diffuse, multifocal/patchy). 530 
CT Imaging and quantitative analysis of lung pathology . The animals were anesthetized using 531 
Telazol (2-6mg/kg) and maintained by inhaled isoflurane delivered through Hallowell 2002 532 
ventilator anesthesia system (Hallowell, Pittsfield, MA). Animals were intubated to perform end- 533 
inspiratory breath-hold using a remote breath-hold switch. Lung field CT images were acquired 534 
using Multiscan LFER150 PET/CT (MEDISO Inc., Budapest, Hungary) scanner. Image analysis was 535 
performed using 3D ROI tools available in Vivoquant (Invicro, Boston, MA). Percent change in 536 
lung hyperdensity was calculated to quantify lung pathology (1, 2). The lung volume involved in 537 
pneumonia, was quantified as follows:  briefly, lung segmentation was performed using a 538 
connected thresholding feature, to identify lung ROI by classifying all the input voxels of scan in 539 
the range of -850 HU to -500 HU. Smoothing filters were used to reassign every ROI voxel value 540 
to the mode of the surrounding region with defined voxel radius and iterations to reconstruct 541 
the Lung ROI. Thereafter, global thresholding was applied to classify the voxels within Lung ROI 542 
in the range of -490 HU to +500 HU to obtain Lung hyperdensity ROI. The resultant ROIs were 543 
then rendered in the maximum intensity projection view using the VTK feature. 544 
 545 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148852
Viral RNA determination . Viral RNA from plasma/sera, BAL, urine, saliva, and swabs 546 
(nasal/nasopharyngeal, oropharyngeal, rectal) and lung homogenates was determined by RT- 547 
qPCR and viral RNA isolation as previously described for MERS-CoV and SARS-CoV (12, 27, 28). 548 
RNA extraction from fluids was performed using the EpMotion M5073c Liquid Handler 549 
(Eppendorf) and the NucleoMag Pathogen kit (Macherey-Nagel). 100 µL of test sample were 550 
mixed with 150 µL of 1X DPBS (Gibco) and 750 µL TRIzol LS. Inactivation controls were prepared 551 
with each batch of samples to ensure no cross contamination occurred during inactivation. 552 
Samples were thawed at room temperature and then, for serum, swabs and urine sampl es 10µg 553 
yeast tRNA was added, along with 1 x 103 pfu of MS2 phage (Escherichia coli bacteriophage MS2, 554 
ATCC). DNA LoBind Tubes (Eppendorf) were prepared with 20 µL of NucleoMag B-Beads 555 
(NucleoMag Pathogen kit, Macherey-Nagel) and 975 µL of Buffer NPB2 (NucleoMag Pathogen kit, 556 
Macherey-Nagel). After centrifugation, the upper aqueous phase of each sample was transferred 557 
to the corresponding new tube containing NucleoMag B-Beads and Buffer NPB2. The samples 558 
were mixed using HulaMixer (Thermo Fisher Scientific Inc.) rotating for 10 min at room 559 
temperature. Samples were then transferred to the sample rack on EpMotion M5073c Liquid 560 
Handler (Eppendorf) for further processing according to NucleoMag Pathogen kit instructions . 561 
For viral RNA determination from tissues, 100mg of tissue was homogenized in 1mL Trizol 562 
Reagent (Invitrogen, Grand Island, NY, USA) with a Qiagen (Germantown, MD, USA) steel bead 563 
and Qiagen Stratagene TissueLyser. For detection of infectious virus, briefly, tissues were 564 
homogenized 10% w/v in viral transport medium using Polytron PT2100 tissue grinders 565 
(Kinematica). After low-speed centrifugation, the homogenates were frozen at −70°C until they 566 
were inoculated on Vero E6 cell cultures in 10-fold serial dilutions. The SARS-CoV-2 RT-qPCR was 567 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148853
performed using a CDC-developed 2019 -nCoV_N1 assay with the TaqPath™ 1-Step RT-qPCR 568 
Master Mix, CG (ThermoFisher). The assays were performed on a QuantStudio 3 instrument 569 
(Applied Biosystems) with the following cycling parameters: Hold stage 2 min at 25°C, 15 min at 570 
50°C, 2 min at 95°C. PCR stage 45 cycles of 3 s at 95°C, 30 s at 60°C. Primer and probe info: 2019- 571 
nCoV_N1-F: GACCCCAAAATCAGCGAAAT (500nM); 2019-nCoV_N1-R: 572 
TCTGGTTACTGCCAGTTGAATCTG (500 nM); 2019-nCoV_N1-P FAM/MGB probe: 573 
ACCCCGCATTACGTTTGGTGGACC (125nM ). 574 
 575 
Pathology . Animals were euthanized and complete necropsy was performed. Gross images (lung, 576 
spleen, liver) and organ weights (lymph nodes, tonsil, spleen, lung, liver, adrenal glands) were 577 
obtained at necropsy. Representative samples of lung lymph nodes (inguinal, axillary, mandibular 578 
and mediastinal), tonsil, thyroid gland, trachea, heart, spleen, liver, kidney, adrenal gland, 579 
digestive system (stomach, duodenum, jejunum, ileum, colon, and rectum), testes or ovary, 580 
brain, eye, nasal tissue, and skin were collected for all animals. Tissues were fixed in 10% neutral 581 
buffered formalin, processed to paraffin, sectioned at 5 um thickness, stained with hematoxylin 582 
and eosin utilizing standard methods, and evaluated by a board-certified veterinary pathologist. 583 
 584 
Tissue processing , flow cytometry, multiplex cytokine analyses, immunohistochemistry, 585 
multicolor confocal microscopy and RNAseq for immune evaluations . 586 
Flow cytometry was performed as previously described 24-26 on blood and BAL samples collected 587 
on time points days 3, 6, 9, 12, and at endpoint, which occurred at 14-17 dpi for various animals. 588 
A comprehensive list of antibodies used in these experiments is provided in Table S7. For 589 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148854
evaluations on peripheral blood, PBMC were prepared as previously described. Briefly, Cellular 590 
phenotypes were studied using antibodies:  CD3 (clone SP34-2), CD4 (clo ne L200), CD69 (clone 591 
FN50), CD20 (2H7), CD95 (clone DX2), KI67 (B56), CCR5 (3A9), CCR7(clone 3D12), CD28 (clone 592 
CD28.2), CD45 (clone D058 -1283),  CXCR3 (clone 1C6/CXCR3), HLA-DR (clone L243), CCR6 (clone 593 
11A9), LAG-3 (Polyclonal, R&D Systems, Minneapolis, MN, USA), CD123 (clone 7G3), CD14 (clone 594 
M5E2), CD206 (clone 206), CD16 (clone 3G8), CD163 (GHI/61), CD66abce (Clone TET2, Miltenyi 595 
Biotech, USA), CD40 (clone 5C3), IL-2(clone MQ1-17H12) , Granzyme-B (clone GB11)  all 596 
purchased from BD Biosciences (San Jose, CA, USA) unless specified. CD8 (clone RPA-T8), CD11c 597 
(clone 3.9), TNF -alpha (clone MAb11), IFN-gamma (clone B27), IL-17 (clone BL168) and PD-1 598 
(clone EH12.2H7) were purchased from BioLegend, San Diego, CA, US. For antigenic stimulation 599 
cells were cultured overnight with SARS-CoV-2 specific peptide pools of the nucleocapsid (N), 600 
membrane (M) and spike (S) proteins (PepTivator SARS-CoV-2 peptide pool, Miltenyi Biotech, 601 
USA). A detailed gating strategy for detection and enumeration of various cellular phenotypes is 602 
described (Fig S18).  603 
 604 
Immuno-histochemistry was performed on 4 µm thick sections of lung, nasal cavity and tonsils. 605 
The sections were baked at 650C for 30 min follo wed by de -paraffinization using Xylene and 606 
subsequent hydration with decreasing gradations of ethanol as described 11,27. Heat induced 607 
antigen retrieval was performed using Sodium citrate buffer (10mM, pH 6.0) followed by blocking 608 
(3 % BSA in TBST for 1 h at 370C). For SARS CoV-2 detection, specimens were incubated with 609 
rabbit SARS CoV-2 spike (S) antibody (ProSci, USA, 1:200, 370C for 2 h)  or anti-SARS CoV-2 610 
nucleocapsid (N) antibody (Sino Biologicals, USA, 1:100, 2h at 370C). Antihuman ACE-2 (R&D 611 
Systems, USA, 1:50, 2h at 370C) was used for identification of ACE-2.  Mouse anti-human 612 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148855
CD66abce-PE conjugated (Miltenyi Biotech, USA, 1:20, 2 h at 370C) was used for identification of 613 
neutrophils; mouse CD68 (Thermo Fisher Scientific, USA, 1:100, 2 h at 370C) for macrophages and 614 
pDC’s were identified by co-staining of PE conjugated mouse anti-human CD123 (BD Biosciences, 615 
USA, 1:20, 370C for 2h) and mouse anti-human HLA-DR antibody (Thermo Fisher Scientific, USA, 616 
1:100, 2 h at 370C). Also, mouse anti-Ki67 (BD Biosciences, USA, 1:50, 2 h at 370C) was used for 617 
detection of actively proliferating cells. Chicken anti-rabbit IgG (H+L), Alexa Fluor 488 conjugate; 618 
goat anti-mouse IgG (H+L), Alexa Fluor 647 conjugate; donkey anti-mouse IgG (H+L), Alexa-Fluor 619 
555 conjugate secondary antibodies (Thermo Fisher Scientific, USA, 1:400, 1 h at 370C) were used 620 
for labelling Spike, Ki67 and HLA-DR, CD68 primary antibodies respectively. Tissue sections were 621 
then stained with DAPI (Thermo Fisher Scientific, USA, 1:5000, 5 min at 370C) with subsequent 622 
mounting with Prolong Diamond Antifade mountant (Thermo Fisher Scientific, USA). Ziess LSM 623 
800 confocal microscope was used to visualize the stained sections (10X, 20X and 63X 624 
magnification). 625 
 626 
RNA was isolated, RNAseq performed and data analyzed as described 16.  627 
 628 
 629 
Statistical analyses . Statistical analyses . Graphs were prepared and statistical comparisons 630 
applied using GraphPad Prism version 8 (La Jolla, CA). Various statistical comparisons were 631 
performed viz. 2-tailed Student’s t-test, ordinary analysis of variance (ANOVA) or one-way or two- 632 
way repeated measure analysis of variance (rmANOVA) with Geisser-Greenhouse correction for 633 
sphericity and Tukey’s post hoc correction for multiple-testing (GraphPad Prism 8) was applied 634 
wherev er applicable and as described in the figure legends. For Correlation analysis, Spearman’s 635 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148856
rank test was applied. Statistical differences between groups were reported significant when the 636 
p-value is less than or equal to 0.05. The data are presented in mean ± SEM.  637 
 638 
Author Contributions. DK, LSS, RC, LDG designed these studies. DKS, SRG, BS, JC,  KJA, RE, T-HL, 639 
MG, YG-G, RS, AC, RT, MG, CA, AB, JF, CB, HS, LP, JC, AM, BK, RNP, PE, VH, XA, AB, CK, MA, BR 640 
conducted the experiments and acquired the data. EC, AG, JD, SH-U, PAF, CNR, KS, CC, CH, OG, 641 
JD, AKV, CH, EJD and KB provided veterinary, veterinary pathology, imaging, colony management 642 
or management expertise; DKS, SRG, BS, KJA, AC, MG, EC, RNP, JS, AO, DKA, RC, BR, TJCA, SAK, 643 
MM, LDG, RC and DK analyzed the data; DK wrote the paper; LSS, JT, LDG, RC, JBT, KB, EC, LMS, 644 
JLP, SG and DKS provided assistance with writing the paper.  645 
 646 
Acknowledgments. We acknowledge exceptional work by our SNPRC veterinary technical and 647 
care staff (especially the veterinary technical/animal care groups headed by Tyneshia Camp, 648 
Wade Hodgkins, Manuel Aguilar, David Vandenberg and Laura Rumpf) as well as the entire SNPRC 649 
and Texas Biomed administrative staff, especially Helen Hawn, for assistance with this study , 650 
especially during trying times. 651 
 652 
Statement on conflict of interests:  “RC, Jr is funded by Regeneron, Inc. This funder had no role, 653 
however, in the design and execution of the experiments and the interpretation of data. The 654 
authors declare that no other financial conflict of interest exists.” 655 
 656 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148857
Financial support. This work was primarily supported by a philanthropic award to Texas Biomed 657 
Coronavirus Working Group; a SNPRC Pilot study award to LDG, RC, JP, LM and JBT; an award to 658 
RC, Jr from Regeneron Pharmaceuticals, (contract # 2020_004110) in part with federal funds from 659 
the Department of Health and Human Services; Office of the Assistant Secretary for Preparedness 660 
and Response; Biomedical Advanced Research and Development Authority, under Contract No. 661 
HHSO100201700020C; and institutional NIH awards P51OD111033 and U42OD010442. The 662 
views expressed here are those of the authors and do not necessarily represent the views or 663 
official position of the funding agencies. 664 
 665 
References 666 
1 Callaway, E., Cyranoski, D., Mallapaty, S., Stoye, E. & Tollefson, J. The coronavirus 667 
pandemic in five powerful charts. Nature  579, 482 -483, doi:10.1038/d41586 -020-00758- 668 
2 (2020).  669 
2 Bucsan, A. N., Mehra, S., Khader, S. A. & Kaushal, D. The current state of animal models 670 
and genomic approaches towards identifying and validating molecular determinants of 671 
Mycobacterium tuberculosis infection and tuberculosis disease. Pathog Dis 77, 672 
doi:10.1093/femspd/ftz037 (2019). 673 
3 Gretebeck, L. M. & Subbarao, K. Animal models for SARS and MERS coronaviruses. Curr 674 
Opin Virol 13, 123 -129, doi:10.1016/j.coviro.2015.06.009 (2015).  675 
4 Rockx, B. et al. Comparative pathogenesis of COVID-19, MERS, and SARS in a nonhuman 676 
primate model. Science, doi:10.1126/science.abb7314 (2020). 677 
5 Munster, V. J. et al. Respiratory disease in rhesus macaques inoculated with SARS-CoV-2. 678 
Nature , doi:10.1038/s41586 -020-2324-7 (2020).  679 
6 Yu, J.  et al. DNA vaccine protection against SARS-CoV-2 in rhesus macaques. Science, 680 
doi:10.1126/science.abc6284 (2020). 681 
7 Chandrashekar, A. et al. SARS-CoV-2 infection protects against rechallenge in rhesus 682 
macaques. Science, doi:10.1126/science.abc4776 (2020). 683 
8 Cockrell, A. S.  et al. A spike-modified Middle East respiratory syndrome coronavirus 684 
(MERS-CoV) infectious clone elicits mild respiratory disease in infected rhesus macaques. 685 
Sci Rep 8, 10727, doi:10.1038/s41598 -018-28900-1 (2018).  686 
9 Mantlo, E., Bukreyeva, N., Maruyama, J., Paessler, S. & Huang, C. Antiviral activities of 687 
type I interferons to SARS-CoV-2 infection. Antiviral Res 179, 104811, 688 
doi:10.1016/j.antiviral.2020.104811 (2020). 689 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148858
10 Nile, S. H. et al. COVID-19: Pathogenesis, cytokine storm and therapeutic potential of 690 
interferons. Cytokine Growth Factor Rev , doi:10.1016/j.cytogfr.2020.05.002 (2020). 691 
11 Bucsan, A. N. et al. Mechanisms of reactivation of latent tuberculosis infection due to SIV 692 
co-infection. J Clin Invest, doi:10.1172/JCI125810 (2019). 693 
12 Gautam, U. S. et al. In vivo inhibition of tryptophan catabolism reorganizes the 694 
tuberculoma and augments immune-mediated control of Mycobacterium tuberculosis. 695 
Proc Natl Acad Sci U S A 115, E62-E71, doi:10.1073/pnas.1711373114 (2018). 696 
13 Cai, Y. et al. In vivo characterization of alveolar and interstitial lung macrophages in rhesus 697 
macaques: implications for understanding lung disease in humans. J Immunol 192, 2821 - 698 
2829, doi:10.4049/jimmunol.1302269 (2014).  699 
14 Kuroda, M. J.  et al. High Turnover of Tissue Macrophages Contributes to Tuberculosis 700 
Reactivation in Simian Immunodeficiency Virus-Infected Rhesus Macaques. J Infect Dis, 701 
doi:10.1093/infdis/jix625 (2018).  702 
15 Barber, D. L.  et al. Restoring function in exhausted CD8 T cells during chronic viral 703 
infection. Nature  439, 682 -687, doi:10.1038/nature04444 (2006). 704 
16 Ahmed, M. et al. Immune correlates of tuberculosis disease and risk translate across 705 
species. Sci Transl Med 12, doi:10.1126/scitranslmed.aay0233 (2020). 706 
17 Darrah, P. A. et al. Prevention of tuberculosis in macaques after intravenous BCG 707 
immunization. Nature  577, 95-102, doi:10.1038/s41586-019-1817-8 (2020).  708 
18 Veazey, R. S. et al. Gastrointestinal tract as a major site of CD4+ T cell depletion and viral 709 
replication in SIV infection. Science 280, 427 -431 (1998).  710 
19 Barouch, D. H., Klasse, P. J., Dufour, J., Veazey, R. S. & Moore, J. P. Macaque studies of 711 
vaccine and microbicide combinations for preventing HIV-1 sexual transmission. Proc Natl 712 
Acad Sci U S A 109, 8694 -8698, doi:10.1073/pnas.1203183109 (2012). 713 
20 Cox, L. A.  et al. Nonhuman Primates and Translational Research-Cardiovascular Disease. 714 
ILAR J 58, 235 -250, doi:10.1093/ilar/ilx025 (2017). 715 
21 Rincon-Choles, H. et al. Renal histopathology of a baboon model with type 2 diabetes. 716 
Toxicol Pathol 40, 1020 -1030, doi:10.1177/0192623312444025 (2012).  717 
22 Cole, S. A., Laviada-Molina, H. A., Serres-Perales, J. M., Rodriguez-Ayala, E. & 718 
Bastarrachea, R. A. The COVID-19 Pandemic during the Time of the Diabetes Pandemic: 719 
Likely Fraternal Twins? Pathogens 9, doi:10.3390/pathogens9050389 (2020). 720 
23 Kaushal, D. et al. Mucosal vaccination with attenuated Mycobacterium tuberculosis 721 
induces strong central memory responses and protects against tuberculosis. Nat Commun 722 
6, 8533, doi:10.1038/ncomms9533 (2015).  723 
24 Bucsan, A. N. et al. Mechanisms of reactivation of latent tuberculosis infection due to SIV 724 
coinfection. J Clin Invest 129, 5254 -5260, doi:10.1172/JCI125810 (2019). 725 
25 Foreman, T. W. et al. Isoniazid and Rifapentine Treatment Eradicates Persistent 726 
Mycobacterium tuberculosis in Macaques. Am J Respir Crit Care Med, 727 
doi:10.1164/rccm.201903 -0646OC (2019).  728 
26 Foreman, T. W. et al. CD4+ T-cell-independent mechanisms suppress reactivation of 729 
latent tuberculosis in a macaque model of HIV coinfection. Proc Natl Acad Sci U S A  113, 730 
E5636 -5644, doi:10.1073/pnas.1611987113 (2016). 731 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148859
27 Mehra, S. et al. Granuloma correlates of protection against tuberculosis and mechanisms 732 
of immune modulation by Mycobacterium tuberculosis. J Infect Dis 207, 1115 -1127, 733 
doi:10.1093/infdis/jis778 (2013).  734 
28 Joosten, S. A. et al. Mycobacterium tuberculosis peptides presented by HLA-E molecules 735 
are targets for human CD8 T-cells with cytotoxic as well as regulatory activity. PLoS Pathog 736 
6, e1000782, doi:10.1371/journal.ppat.1000782 (2010). 737 
29 Raju, R. M. et al. Post-translational regulation via Clp protease is critical for survival of 738 
Mycobacterium tuberculosis. PLoS Pathog 10, e1003994, 739 
doi:10.1371/journal.ppat.1003994 (2014). 740 
30 Winglee, K. et al. Aerosol Mycobacterium tuberculosis infection causes rapid loss of 741 
diversity in gut microbiota. PLoS One  9, e97048, doi:10.1371/journal.pone.0097048 742 
(2014).  743 
 744 
 745 
 746 
 747 
 748 
 749 
 750 
 751 
 752 
 753 
 754 
 755 
 756 
 757 
 758 
 759 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148860
Figure legends 760 
 761 
Figure 1. Clinical correlates of SARS-CoV-2 infection in rhesus macaques over 0 -3 dpi. Changes 762 
in serum CRP (mg/L) (a), albumin (ALB) (g/dL) (b), hemoglobin  (HGB) content (g/dL) (c), 763 
longitudinally in peripheral blood. Viral RNA (log 10 copies/mL were measured by RT-PCR in BAL 764 
fluid (d), nasopharyngeal (e), and buccopharyngeal (f) swabs longitudinally (red – 0 dpi; purple – 765 
1 dpi; blue – 2 dpi; green – 3 dpi) . Viral RNA was also measured in lung tissue homogenates at 766 
endpoint (3 dpi) and data is expressed as log 10 copies/gram of the lung tissue for random samples 767 
from three lobes in left (orange) and right (teal) lungs (g Hematoxylin and eosin (H&E) staining 768 
was performed on formalin-fixed paraffin-embedded (FFPE) lung sections from infected animals 769 
for pathological analysis Histopathologic analysis revealed bronchitis characterized by infiltrates 770 
of macrophages, lymphocytes, neutrophils, and eosinophils that expanded the wall (bracket), 771 
and along with syncytial cells (arrows) filled the bronchiole lumen and adjacent alveolar spaces. 772 
(h); Suppurative interstitial pneumonia with Type II pneumocyte hyperplasia (arrowheads) and 773 
alveolar space filled with neutrophils, macrophages and fibrin (*).  Bracket denotes alveolar 774 
space. (i). Multilabel confocal immunofluorescence microscopy of lungs (j) and nasal epithelium 775 
(k) at 63x with Nucleocapsid (N) specific antibody (green) DAPI (blue), and ACE2 (red). (a-f) Data 776 
is represented as mean+ SEM (n=4). ). (c-g) Undetectable results are represented as 1 copy. One 777 
way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s 778 
post hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, 779 
*** P<0.0005.  780 
 781 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148861
 782 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148862
Figure 2. Radiologic evaluation of the lung compartment following SARS-CoV-2 infection in 783 
rhesus macaques over 0-3 dpi including by hyperdensity analyses. CXR (a) and CT (e) scores 784 
generated by a veterinary radiologist blinded to the experimental group (red – 0 dpi;  purple – 1 785 
dpi; blue – 2 dpi; green – 3 dpi) .  (a) Data is represented as mean+ SEM (n=4). One way Repeated- 786 
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 787 
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.05.  Representative CT scan 788 
images performed on Day 0-2 dpi show (b) transverse, (c) vertical, (d) longitudinal view of left 789 
caudal lobe ground glass opacity on 1 dpi (middle), 2 dpi 28 and baseline at 0 dpi (upper inset). CT 790 
scans (b-d) revealed evidence of pneumonia and lung abnormalities in the infected animals 791 
relative to controls which resolved between 1 to 2 dpi (red arrow).  3D reconstruction (f) of ROI 792 
volume representing the location of lesion. (Fig 2g-i) represent image for quantification of lung 793 
lesion with green area representing normal intensity lung voxels (-850 HU to -500 HU), while red 794 
areas represent hyperdense voxels (-490 HU to 500 HU). Percent change in lung hyperdensity in 795 
SARS-CoV2 infected animals over Day 1-3 dpi compared to the baseline(j). (re d – 0 dpi; purple – 796 
1 dpi; blue – 2 dpi; green – 3 dpi). (e, j) Data represented as (mean + SEM) (n=4 for 0-2 dpi, n=2 797 
for 3dpi). Ordinary one-way ANOVA with Dunnett’s post hoc test was applied. 798 
 799 
 800 
 801 
 802 
 803 
 804 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148863
 805 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148864
Figure 3. SARS-CoV-2 induced alveolar inflammation. Simultaneous analysis of multiple 806 
cytokines by Luminex technology in the BAL fluid of rhesus macaques over 0-3 dpi. Levels of IL-6 807 
(a), IFN-a (b), IFN-g (c), IL-8 (d), perforin (e), IP-10 (f), MIP1a (g), MIP1b (h), IL-12p40 (i), IL-18 (j), 808 
TNF (k) and IL-1Ra (l) are expressed in Log10 concentration in picogram per mL of BAL fluid. (red 809 
– 0 dpi; purple – 1 dpi; blue – 2 dpi; green – 3 dpi). Data is represented as mean+ SEM (n=4). One 810 
way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s 811 
post hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, 812 
*** P<0.0005.  813 
 814 
 815 
 816 
 817 
 818 
 819 
 820 
 821 
 822 
 823 
 824 
 825 
 826 
  827 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148865
 828 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148866
Figure 4. Longitudinal  clinical and histopathological correlates of SARS-CoV-2 infection in 829 
rhesus macaques, baboons and marmosets over two weeks. Viral RNA (log 10 copies/mL were 830 
measured by RT-PCR in BAL fluid (a) and nasopharyngeal (b) swabs of SARS-CoV-2 infected rhesus 831 
macaques longitudinally (red – 0 dpi; purple – 3 dpi; black – 6 dpi: blue – 9 dpi; orange – 12 dpi: 832 
green – 14-17 dpi). (n=12) One way Repeated-measures ANOVA with Geisser-Greenhouse 833 
correction for sphericity and Tukey’s post hoc correction for multiple-testing (GraphPad Prism 8) 834 
was applied. * P<0.005, *** P<0.0005. Viral RNA was also measured in lung tissue homogenates 835 
of infected rhesus macaques at endpoint (14-17 dpi) and data is expressed as log 10 copies/gram 836 
of the lung tissue for random samples from three lobes in left (orange) and right (teal) lungs (c). 837 
Histopathologic analysis revealed regionally extensive interstitial lymphocytes, plasma cells, 838 
lesser macrophages and eosinophils expanding the alveolar septa (bracket) and alveolar spaces 839 
filled with macrophages (*).  Normal alveolar wall is highlighted (arrow) for comparison (d). 840 
Alveolar spaces with extensive interstitial alveolar wall thickening by deposits of collagen (*) and 841 
scattered alveolar macrophages (arrow) (e). Viral RNA (log 10 copies/mL were  measured by RT- 842 
PCR in BAL fluid (f) and Nasopharyngeal (g) swab from SARS-CoV-2 infected baboons. (n=6) One 843 
way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s 844 
post hoc correction for multiple-testing (GraphPad Prism 8) was applied. Histopathologic analysis 845 
revealed regionally extensive interstitial lymphocytes, plasma cells, lesser macrophages and 846 
eosinophils expanding the alveolar septa (bracket) and alveolar spaces filled with macrophages 847 
(*), (h). Alveolar wall thickening by interstitial deposits of collagen (*), alveoli lined by occasional 848 
type II pneumocytes (arrowhead) and alveolar spaces containing syncytial cells (arrow) and 849 
alveolar macrophages (i). Viral RNA (log 10 copies/mL were measured by RT-PCR in marmoset 850 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148867
nasal wash (j) and oral (k) swabs longitudinally (red – 0 dpi; purple – 3 dpi; blue – 6 dpi; green – 851 
9 dpi; black – 14-17 dpi). n=6 for 0-3 dpi and n=4 for 6-14 dpi) . .Histopathologic analysis revealed 852 
milder form of  interstitial lymphocytes, and macrophages recruited to the alveolar space (m, n). 853 
Ordinary one-way ANOVA with Dunnett’s post hoc test was applied. Viral RNA was also measured 854 
in lung homogenates at endpoint (3 dpi & 14 dpi) and data is expressed as log 10 copies/gram of 855 
the lung for random samples from left and right lobes at 3 dpi (orange) and 14 dpi (teal) (g). Data 856 
is represented as mean+ SEM. ** P<0.005, **** P<0.00005.  857 
 858 
 859 
 860 
 861 
 862 
 863 
 864 
 865 
 866 
 867 
 868 
 869 
 870 
 871 
 872 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148868
 873 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148869
 874 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148870
Figure 5. CXR (a) scores generated by a veterinary radiologist blinded to the experimental group 875 
(n=12) and (b) CXR scores split in old and young macaques (n=6). CXR radiographs showing 876 
minimal right caudal interstitial pattern at 0 dpi (c), Alveolar pattern associated with the caudal 877 
sub segmen t of the left cranial lung lobe and left caudal lung lobe with patchy right caudal 878 
interstitial opacity at 6 dpi (d) and Minimal left caudal interstitial pattern at 14dpi (e).  CT (f) scores 879 
generated by a blinded veterinary radiologist (n=6). 3D reconstruction (g,k) of ROI volume 880 
representing the location of lesion. (h-j, l -n) represent image for quantification of lung lesion with 881 
green area representing normal intensity lung voxels (-850 HU to -500 HU), while red areas 882 
represent hyperdense voxels (-490 HU to 500 HU). Percent change in lung hyperdensity in SARS- 883 
CoV2 infected animals over 6 dpi compared to 12 dpi (o) (n=6). Data is represented as mean+ 884 
SEM. (a) One way & (b) two way Repeated-measures ANOVA with Geisser-Greenhouse correction 885 
for sphericity and Tukey’s post hoc correction for multiple-testing and (f,o) Paired T test 886 
(GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** P<0.0005.  887 
 888 
 889 
 890 
 891 
 892 
 893 
 894 
 895 
 896 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148871
 897 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148872
Figure 6. Longitudinal accumulation of myeloid cells in BAL following SARS-CoV-2 infection in 898 
rhesus macaques.  Flow cytometric analysis of BAL IMs (a, e), AMs (b, f), neutrophils (c,g), and 899 
pDCs (d, h). Data shown combined for age (a-d) (n=12); data split by age (g-h) (n=6). Data is 900 
represented as mean+ SEM. (a-d) One way and (e-h) two way Repeated-measures ANOVA with 901 
Geisser -Greenhouse correction for sphericity and Tukey’s post hoc correction for multiple-testing 902 
(GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** P<0.0005. Coloring scheme for e -h 903 
– young (blue), old (red). Correlations with Spearman’s rank test between cellular fraction and 904 
Log10 viral RNA copy number in BAL (i) and corresponding values for Spearman's rank correlation 905 
coefficient (j) and P value (Suppl. Fig13i).  Coloring scheme for i – Neutrophil (blue), IM (red), AM 906 
(orange, pDC (green). Multilabel confocal immunofluorescence microscopy of FFPE lung sections 907 
from SARS CoV-2 infected Rhesus macaques having a high viral titer at 3 dpi (k-p) with SARS CoV- 908 
2 Spike specific antibody (green), KI-67 29, neutrophil marker CD66abce (red) and DAPI (blue) at 909 
10X (k) and 63X (l); SARS CoV-2 Spike (green), pan-macrophage marker CD68 (red) and DAPI 910 
(blue) at 10X (m) and 63X (n); SARS CoV-2 Spike (green), HLA-DR 29, pDC marker CD123 (red) and 911 
DAPI (blue) at 10X (o) and 63X (p).  912 
 913 
 914 
 915 
 916 
 917 
 918 
 919 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148873
 920 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148874
Figure 7. Longitudinal changes in T cells in BAL following SARS-CoV-2 infection in rhesus 921 
macaques.  BAL Frequencies of CD3+ T cells (a), CD4+ T cells (b), CD8+ T cells (g), CD4+ T cell subsets 922 
expressing early activation marker CD69 (c), CXCR3 (d), PD-1 (e) and memory marker CCR7 (f), 923 
CCR5 (l), HLA-DR (m) and LAG-3 (n);  CD8+ T cell subsets expressing early activation marker CD69 924 
(h), CXCR3 (i), PD-1 (j) and memory marker CCR7 (k), CCR5 (o), HLA-DR (p) and LAG-3 (q). Coloring 925 
scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=6) Two way Repeated- 926 
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 927 
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 928 
P<0.0005. 929 
 930 
 931 
 932 
 933 
 934 
 935 
 936 
 937 
 938 
 939 
 940 
 941 
 942 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148875
 943 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148876
Figure 8. Longitudinal changes in memory T cells in BAL following SARS-CoV-2 infection in 944 
rhesus macaques . BAL Frequencies of CD4+ T cell subsets expressing KI67 (a), Memory (b), Naïve 945 
(c), Effector (d), IL-2 (e) and Granzyme B (f). Frequencies of CD8+ T cell subsets expressing KI67 946 
(g), Memory (h), Naïve (i), Effector (j), IL-2 (k) and Granzyme B (l). BAL cells were stimulated 947 
overnight (12-14 hours) with either Mock control (U); PMA-Ionomycin (P/I) or SARS-CoV-2 - 948 
specific peptide pools of the nucleocapsid (N), membrane (M) and spike (S) proteins. Antigen 949 
specific cytokine secretion in T cells was estimated by flow cytometry. Fraction of CD4+ T cells 950 
secreting IL-2 (m), Granzyme B (n); CD8+ T cells secreting IL-2 (o) and Granzyme B (p). Coloring 951 
scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=6) two way Repeated- 952 
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 953 
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 954 
P<0.0005. 955 
 956 
 957 
 958 
 959 
 960 
 961 
 962 
 963 
 964 
 965 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148877
 966 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148878
Figure S1. Clinical correlates in short -term (0 -3 dpi) rhesus macaques.  Serum levels of tCO2 (D- 967 
mmol/L) (a), and whole blood levels of Red Blood Cells (RBCs) (million/mL) (b), reticulocytes 968 
(K/mL) (c), White Blood Cells (WBCs) (K/mL) (d), platelets (K/uL) (e), Neutrophils (K/mL) (f), 969 
percentage of Neutrophils (g), percentage of monocytes (h). Viral RNA (log 10 copies/mL were 970 
measured by RT-PCR in saliva (i), and rectal swab (j). ) Data is represented as mean+ SEM (n=4). 971 
One way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and 972 
Tukey’s post hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** 973 
P<0.005, *** P<0.0005.  974 
 975 
 976 
 977 
 978 
 979 
 980 
 981 
 982 
 983 
 984 
 985 
  986 
 987 
 988 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148879
 989 
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148880
Figure S2. Gross and histopathologic findings of young and aged male and female Rhesus 990 
macaques experimentally exposed to COVID19 - 3 dpi. Young male Rhesus macaque. Lung was 991 
grossly unremarkable (a). Aged male Rhesus macaque. Lung. The dorsal aspect of the lungs was 992 
mottled red (*) (b). Aged male Rhesus macaque. Lung. Sub gross image showing extensive areas 993 
of consolidation (*) (c). Aged male Rhesus macaque. Lung.  Moderate interstitial pneumonia with 994 
scattered type II pneumocytes (arrow), neutrophils (arrowhead), and intra-alveolar fibrin 995 
deposition (*) (d). Aged female Rhesus macaque. Lung. Mild interstitial pneumonia with 996 
scattered syncytial cells (arrow), neutrophils (arrowhead), and expansion of alveolar walls by 997 
fibrosis (bracket) (e). Young female Rhesus macaque. Lung.  Vasculitis. Vascular wall disrupted by 998 
infiltrates of mononuclear cells and lesser neutrophils.  Vessel lumen marked by (*) (f). Young 999 
female Rhesus macaque. Lung. Mild interstitial pneumonia.  Alveolar spaces contain neutrophils 1000  
and cellular debris (necrosis, arrow) (g). Young female Rhesus macaque. Lung. Mild interstitial 1001  
pneumonia.  Alveolar spaces (*) contain neutrophils and eosinophilic fluid (edema) (h). Young 1002  
female Rhesus macaque. Lung. Bronchiolitis. Bronchiolar wall expanded by infiltrate s of 1003  
lymphocytes and macrophages (bracket) (i). Young male Rhesus macaque. Lung. Bronchitis. 1004  
Bronchial wall expanded by infiltrates of eosinophils that expand and disrupt the epithelium and 1005  
smooth muscle (bracket) (j). Young female Rhesus macaque. Lung. Bronchitis. Bronchial lumen 1006  
contains macrophages (arrowhead), cellular debris, and syncytial cells (arrow) (k). Aged female 1007  
Rhesus macaque. Lung. Area of bronchiolar associated lymphoid tissue (BALT) (*) (l). All slides 1008  
were stained with H&E. 1009  
 1010  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148881
 1011  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148882
Fig S3. Multi-label confocal immunofluorescence microscopy of lungs (20X-a, 63X-g), nasal 1012  
epithelium (20X-b, 63x -h) and tonsil (20X-c,63X-i) with SARS CoV-2 N specific antibody (green), 1013  
DAPI (blue) and ACE-2 (red). Rabbit IgG isotype control antibody was used to rule out non-specific 1014  
staining in lungs (20X-d, 63X -j), nasal epithelium (20X-e, 63x -k) and tonsil (20X-f, 63X -l). Staining 1015  
in naïve rhesus macaque lung tissues did not show N signal in lungs (m) or nasal epithelium (n).  1016  
 1017  
 1018  
 1019  
 1020  
 1021  
 1022  
 1023  
 1024  
 1025  
 1026  
 1027  
 1028  
 1029  
 1030  
 1031  
 1032  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148883
 1033  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148884
Figure S4. Multi-label confocal immunofluorescence microscopy of lungs (10X-a, 63X-g), nasal 1034  
epithelium (10X-b, 63x-h) and tonsil (10X-c,63X-i) with SARS CoV-2 S specific antibody (green) 1035  
and DAPI (blue). Rabbit IgG isotype control antibody was used to stain the tissues to rule out any 1036  
non-specific staining. The panels showing isotype control staining include: lungs (10X-d, 63X -j), 1037  
nasal epithelium (10X-e, 63X-k) and tonsil (10X-f, 63X -l). 1038  
 1039  
 1040  
 1041  
 1042  
 1043  
 1044  
 1045  
 1046  
 1047  
 1048  
 1049  
 1050  
 1051  
 1052  
 1053  
 1054  
 1055  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148885
  
  
  
  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148886
Figure S5. Radiology of Rhesus macaques experimentally exposed to COVID19 - 3 dpi. CXR 1060  
Radiographs showing ventrodorsal and right lateral views(a). Day 0: Normal, Day 1: Mild left 1061  
caudal interstitial opacity with minimal diffuse right interstitial opacity, Day 2: Mild multifocal 1062  
interstitial pattern (red arrow), Day 3: Mild multifocal interstitial pattern with patchy region in 1063  
left caudal lobe (red arrow). CT scan axial view showing lesion characteristics in rhesus macaques 1064  
infected with SARS-CoV-2 (b) at baseline and Day 1-3 dpi. As seen in (b) ground glass opacity seen 1065  
on Day 2 dpi intensified on Day 3 dpi. (c) and (d) show lesions that appear on Day 1 show gradual 1066  
resolution on Day 2-3 dpi whereas lesion in panel (e) observed on Day 1 dpi showed only minimal 1067  
changes on Day 2. Red arrow point towards lung lesions with high attenuation. 1068  
 1069  
 1070  
 1071  
 1072  
 1073  
 1074  
 1075  
 1076  
 1077  
 1078  
 1079  
 1080  
 1081  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148887
 1082  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148888
Figure S6. SARS-CoV-2 induced cytokines in plasma. Simultaneous analysis of multiple cytokines 1083  
by Luminex technology in the plasma of rhesus macaques over 0-3 dpi. Levels of IL-6 (a), IFN-a 1084  
(b), IFN-g (c), IL-8 (d), perforin (e), IP-10 (f), MIP1a (g), MIP1b (h), IL-12p40 (i), IL-18 (j), TNF-a (k) 1085  
and IL-1Ra (l)are expressed in Log10 concentration in picogram per mL of plasma. (red – 0 dpi; 1086  
purple – 1 dpi; blue – 2 dpi; gre en – 3 dpi). (n=4) Data is represented as mean+ SEM. One way 1087  
repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post 1088  
hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1089  
P<0.0005.  1090  
 1091  
 1092  
 1093  
 1094  
 1095  
 1096  
 1097  
 1098  
 1099  
 1100  
 1101  
 1102  
 1103  
 1104  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148889
 1105  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148890
Figure S7. Clinical correlates in long-term (14-17 dpi) rhesus macaques. Serum levels of CRP 1106  
(mg/L) (a), tCO2 (D-mmol/L) (b), and whole blood levels of Red Blood Cells (RBCs) (million/mL) 1107  
(c), reticulocytes (K/mL) (d), percentage of Neutrophils (g), Neutrophils (K/mL) (f), platelets (K/uL) 1108  
(e), percentage of monocytes (h) and percent change in weight (i) (Coloring scheme for I – young 1109  
(blue), old (red).). (a -e) (n=12) Data is represented as mean+ SEM. One way repeated-measures 1110  
ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc correction for 1111  
multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** P<0.0005.  1112  
 1113  
 1114  
 1115  
 1116  
 1117  
 1118  
 1119  
 1120  
 1121  
 1122  
 1123  
 1124  
 1125  
 1126  
 1127  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148891
 1128  
 1129  
 1130  
 1131  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148892
Figure S8. Longitudinal viral RNA determination following SARS-CoV-2 infection in rhesus 1132  
macaques. Viral RNA (log 10 copies/mL measured by RT-PCR in BAL fluid (a) and nasopharyngeal 1133  
(b), buccopharyngeal (c-d) and rectal 30 swabs longitudinally. Data is depicted as combined for 1134  
age (c,e) and data split by age a; b; d; f). Coloring scheme for c; e – (red – 0 dpi; purple – 3 dpi; 1135  
blue – 6 dpi: green – 9 dpi; orange – 12 dpi: black – 14-17 dpi). (n=12) One way Repeated- 1136  
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 1137  
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1138  
P<0.0005. Coloring scheme for a; b; d; f – young (blue), old (red). (n=6) Data is represented as 1139  
mean+ SEM. Two way Repeated-measures ANOVA with Geisser-Greenhouse correction for 1140  
sphericity and Tukey’ s post hoc correction for multiple-testing (GraphPad Prism 8) was applied. 1141  
** P<0.005. 1142  
 1143  
 1144  
 1145  
 1146  
 1147  
 1148  
 1149  
 1150  
 1151  
 1152  
 1153  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148893
 1154  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148894
Figure S9. Longitudinal viral RNA determination following SARS-CoV-2 infection in rhesus 1155  
macaques.  Viral RNA was determined at endpoint in Lungs (a) and longitudinally in plasma (b) 1156  
and urine (c). 1157  
 1158  
 1159  
 1160  
 1161  
 1162  
 1163  
 1164  
 1165  
 1166  
 1167  
 1168  
 1169  
 1170  
 1171  
 1172  
 1173  
 1174  
 1175  
 1176  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148895
 1177  
 1178  
 1179  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148896
Figure S10. Gross and histopathologic findings of young and aged male and female Rhesus 1180  
macaques experimentally exposed to SARS-CoV-2 - 14-17 dpi. Young male Rhesus macaque. 1181  
Lung was grossly unremarkable (a). Aged male Rhesus macaque. The dorsal aspect of the lungs 1182  
was mottled red (b). Young male Rhesus macaque. Lung. Subgross image showing multifocal 1183  
areas of minimal interstitial pneumonia (*) (c). Young female Rhesus macaque. Lung. Mild 1184  
lymphocytic interstitial pneumonia with alveolar septa (bracket) expanded by mononuclear cells 1185  
(lymphocytes and macrophages) (d). Aged female Rhesus macaque. Lung. Mild lymphocytic 1186  
interstitial pneumonia with increased alveolar macrophages and few syncytial cells (arrow) 1187  
within the alveolar lumen (*; a neutrophil is just to the left of the *) and type II pneumocytes 1188  
lining alveoli (arrowhead) (e). Aged female Rhesus macaque. Lung. Minimal interstitial 1189  
pneumonia with alveolar septa expanded by fibrosis (*) and few syncytial cells (arrow) within 1190  
alveoli (f). Young male Rhesus macaque. Lung. Alveolar septa expanded by fibrosis (*) and 1191  
lymphocyte infiltrates (g). Aged male Rhesus macaque. Lung. Areas of bronchiolization (arrows) 1192  
(h). Young female Rhesus macaque. Lung. Vasculitis. Vascular wall disrupted by infiltrates of 1193  
mononuclear cells and lesser neutrophils (arrow) (i). Young female Rhesus macaque. Lung. 1194  
Bronchitis. Bronchial epithelium infiltrated by eosinophils (arrow).  Fibrosis adjacent to bronchus 1195  
(*) (j). Young female Rhesus macaque. Lung. Area of perivascular lymphocyte infiltrates (*) (k). 1196  
Young female Rhesus macaque. Lung.  Area of bronchiolar associated lymphoid tissue (BALT) (*) 1197  
(l). All slides were stained with H&E. 1198  
 1199  
 1200  
 1201  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148897
 1202  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148898
Figure S11. Viral, Gross and histopathologic findings of young male and female baboons 1203  
experimentally exposed to COVID19 - 14-17 dpi. Viral RNA (log 10 copies/mL were measured by 1204  
RT-PCR in buccopharyngeal (a) and rectal (b) swabs longitudinally. Young male baboon. Th e 1205  
dorsal aspect of the lungs was mottled red (*) (c). Young female baboon. The dorsal aspect of the 1206  
lungs was mottled red (*) (d). Young male baboon. Lung. Subgross image showing areas of 1207  
consolidation (*) (e). Young female baboon. Moderate lymphocytic interstitial pneumonia with 1208  
scattered neutrophils (arrowhead) (f). Young female baboon. Moderate lymphocytic interstitial 1209  
pneumonia with alveolar septa (bracket) markedly expanded by mononuclear cells (lymphocytes 1210  
and macrophages) and increased alveolar macrophages within the alveolar lumen (*) (g). Young 1211  
male baboon. Lung. Mild lymphocytic interstitial pneumonia with increased alveolar 1212  
macrophages and few syncytial cells (arrow) within the alveolar lumen (*) (h). Young female 1213  
baboon. Mild lymphocytic interstitial pneumonia with scattered type II pneumocytes (arrows) 1214  
and increased alveolar macrophages and neutrophils within the alveolar lumen (*) (i). Young 1215  
male baboon. Lung. Alveolar septa expanded by fibrosis (*) (j). Young male baboon. Lung. 1216  
Alveolar septa expanded by fibrosis (*) (k). Young female baboon. Area of bronchiolization 1217  
(bracket) (l). Young male baboon. Lung.  Syncytial cells within airways (arrows) (m). Young male 1218  
baboon. Lung. Bronchitis. Bronchial wall expanded by infiltrates of eosinophils that expand and 1219  
disrupt the epithelium (arrow).  Area of bronchiolar associated lymphoid tissue (BALT) (*) (n). All 1220  
slides were stained with H&E. 1221  
 1222  
 1223  
 1224  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148899
 1225  
 1226  
 1227  
 1228  
 1229  
 1230  
 1231  
 1232  
 1233  
 1234  
 1235  
 1236  
 1237  
 1238  
 1239  
 1240  
 1241  
 1242  
 1243  
 1244  
 1245  
 1246  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148900
Figure S12. CT scan in axial view showing lesion characteristics in rhesus macaques infected with 1247  
SARS-CoV-2 from Day 6-12 dpi. As seen in panel A, B, D, E and F patchy alveolar patterns, nodular 1248  
and/or multifocal ground glass opacities (red arrow) seen on Day 6 dpi show dramatic resolution 1249  
by Day 12 dpi, whereas panel C shows persistent patchy ground glass opacity on Day 6 dpi and 1250  
Day 12 dpi. 1251  
 1252  
 1253  
 1254  
 1255  
 1256  
 1257  
 1258  
 1259  
 1260  
 1261  
 1262  
 1263  
 1264  
 1265  
 1266  
 1267  
 1268  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148901
 1269  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148902
Figure S13. Accumulation of various types of myeloid cells in BAL (a-d) and PBMCs (c-h). Total 1270  
myeloid cell compartment in the BAL in all animals (a) (n=12), and in two groups of macaques 1271  
split by age (b). percentage of cDCs (c) and intermediate monocytes (d) in BAL. Percentage of 1272  
interstitial (e) and alveolar (f) macrophages, pDCs (g) and intermediate macrophages (h) in the 1273  
peripheral blood. Coloring scheme for b -h – young (blue), old (red) (n=6). (i) P value table for 1274  
Spearman’s correlation curve in Fig 5i.  1275  
 1276  
 1277  
 1278  
 1279  
 1280  
 1281  
 1282  
 1283  
 1284  
 1285  
 1286  
 1287  
 1288  
 1289  
 1290  
 1291  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148903
 1292  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148904
Figure S14. Detection of SARS-CoV-2 signal in host lung cells by confocal microscopy. Multi-label 1293  
confocal immunofluorescence microscopy of a high viral titer lung lobe from SARS CoV-2 infected 1294  
Rhesus macaque at 3 dpi with SARS CoV-2 Spike specific antibody (green), neutrophil marker 1295  
CD66abce (red) and DAPI (blue)- (10X -a, 63X-g) vs the naïve control lungs (10X-d, 63X -j). SARS 1296  
CoV-2 Spike (green), pan-macrophage marker CD68 (red) and DAPI (blue) in infected lungs (10X- 1297  
b and 63X-h) vs the naïve control lungs (10X-e, 63X -k). SARS CoV-2 Spike (green), HLA-DR 29, pDC 1298  
marker CD123 (red) and DAPI (blue) specific staining in infected lungs (10X-c,63X-i) vs naïve 1299  
control lungs(10X-f, 63X -l). 1300  
 1301  
 1302  
 1303  
 1304  
 1305  
 1306  
 1307  
 1308  
 1309  
 1310  
 1311  
 1312  
 1313  
 1314  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148905
 1315  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148906
Figure S15. Longitudinal changes in cytokine secretion profile in BAL T cells following SARS-CoV- 1316  
2 infection in rhesus macaques . BAL Frequencies of CD4+ T cell subsets expressing Interferon- 𝜸 1317  
(a), IL-17 (b), TNF- 𝛂 (c), CD8+ T cells expressing Interferon- 𝜸 (d), IL-17 (e), TNF- 𝛂 (f) cultured 1318  
overnight without any external antigenic stimulation. BAL cells were also stimulated overnight 1319  
(12-14 hours) with either Mock control (U); PMA-Ionomycin (P/I) or SARS-CoV-2 -specific peptide 1320  
pools of the nucleocapsid (N), membrane (M) and spike (S) proteins. Antigen specific cytokine 1321  
secretion in T cells was estimated by flow cytometry. Fraction of CD4+ T cell subsets expressing 1322  
Interferon-g	 (g), IL-17 (h), TNF-a (i), CD8+ T cells expressing Interferon-g (j), IL-17 (k), TNF-a (l). 1323  
Coloring scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=6) Two way 1324  
Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post 1325  
hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1326  
P<0.0005. 1327  
 1328  
 1329  
 1330  
 1331  
 1332  
 1333  
 1334  
 1335  
 1336  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148907
 1337  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148908
Figure S16. Longitudinal changes in SARS-CoV-2 induced cytokines in BAL fluid and plasma 1338  
following SARS-CoV-2 infection in rhesus macaques over two weeks. Simultaneous analysis of 1339  
multiple cytokines by Luminex technology in the BAL fluid and plasma of rhesus macaque s over 1340  
0-15 dpi. Levels of IFN-a (a), IL-1Ra (b), IFN-g (c), TNF-a (d), IL-6 (e), Perforin (f) are expressed in 1341  
Log10 concentration in picogram per mL of BAL fluid. Levels of IFN-a (g), IL-1Ra (h), IFN-g (i), TNF - 1342  
a (j), IL-6 (k), Perforin (l) are expressed in Log10 concentration in picogram per mL of BAL fluid.  1343  
Coloring scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=12) Two way 1344  
Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post 1345  
hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1346  
P<0.0005.  1347  
 1348  
 1349  
 1350  
 1351  
 1352  
 1353  
 1354  
 1355  
 1356  
 1357  
 1358  
 1359  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148909
 1360  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148910
Figure S17. SARS-CoV-2 infection induces ACE-2 expression . RNAseq was performed on total 1361  
RNA isolated from the lungs of naïve (n=3) and SARS-CoV-2 infected (14-17dpi) rhesus macaques  1362  
(n=8, 3 young and 5 old macaques) as described earlier 16. Results indicate that the expression of 1363  
ACE2, which is lower in naïve animals (denoted by red color in the heat map) (a), was induced 1364  
following SARS-CoV-2 infection (denoted by blue color in the heat map) (a). Relative expression 1365  
level of ACE-2 was significantly higher than in naïve tissues (b). Higher expression of ACE-2 was 1366  
observed in lung tissues obtained at necropsy from young relative to old macaques (c, d), such 1367  
that the difference between naïve animals and young SARS-CoV-2 infected animals in ACE-2 1368  
expression levels was statistically significant by itself. All p-values shown on expression swarm 1369  
plots (b-d) are FDR-corrected significance values for differential expression calculated by DESEQ2 1370  
16. 1371  
 1372  
 1373  
 1374  
 1375  
 1376  
 1377  
 1378  
 1379  
 1380  
 1381  
 1382  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148911
 1383  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148912
Figure S18. Flow cytometry Gating Strategy. Gating strategy for T cell phenotyping is described.  1384  
 1385  
 1386  
 1387  
 1388  
 1389  
 1390  
 1391  
 1392  
 1393  
 1394  
 1395  
 1396  
 1397  
 1398  
 1399  
 1400  
 1401  
 1402  
 1403  
 1404  
 1405  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148913
1406  
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148914
Supplemental tables  1407  
 1408  
Table S1. In vivo experimental design. A. short-term rhesus macaque pilot. B-D. 14-day 1409  
multispecies comparison in rhesus macaques, baboons, marmosets. 1410  
 1411  
Table S2. Distribution of lesions by anatomic location and morphologic diagnosis of young and 1412  
aged rhesus macaques experimentally exposed to SARS-CoV-2 - 3 dpi. 1413  
 1414  
Table S3. Distribution of lesions by anatomic location and morphologic diagnosis of young and 1415  
aged rhesus macaques experimentally exposed to SARS-CoV-2  – 14-17 dpi. 1416  
 1417  
Table S4. Distribution of lesions in baboons experimentally exposed to SARS-CoV-2  – 14-17 dpi. 1418  
 1419  
Table S5. CXR scores in rhesus macaques experimentally exposed to SARS-CoV-2  – 14-17 dpi. 1420  
 1421  
Table S6. CT scores in rhesus macaques experimentally exposed to SARS-CoV-2  – 14-17 dpi. 1422  
 1423  
Table S7. List of antibodies used for immunophenotyping studies. 1424  
 1425  
 1426  
 1427  . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint 
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148915