Document text
Title: SARS-CoV-2 infection leads to acute infection with dynamic cellular and inflammatory flux 1
in the lung that varies across nonhuman primate species 2
Authors: Dhiraj Kumar Singh1,2, Shashank R. Ganatra1,2, Bindu Singh1,2, Journey Cole1,2, Kendra J. 3
Alfson2, Elizabeth Clemmons1,2, Michal Gazi2, Olga Gonzalez1,2, Ruby Escobedo1,2, Tae-Hyung 4
Lee1,2, Ayan Chatterjee1,2, Yenny Goez-Gazi2, Riti Sharan1,2, Rajesh Thippeshappa1,2, Maya 5
Gough1,2, Cynthia Alvarez1,2, Alyssa Blakley1,2, Justin Ferdin1,2, Carmen Bartley1,2, Hilary Staples1,2, 6
Laura Parodi1,2, Jessica Callery1,2, Amanda Mannino1,2, Benjamin Klaffke2, Priscilla Escareno2 , Roy 7
N. Platt II2, Vida Hodara1,2, Julia Scordo2, Adelekan Oyejide3, Dharani K. Ajithdoss3, Richard Copin3, 8
Alina Baum3, Christos Kyratsous3, Xavier Alvarez1,2, Bruce Rosas4, Mushtaq Ahmed4, Anna 9
Goodroe1,2, John Dutton1,2, Shannan Hall-Ursone1,2, Patrice A. Frost1,2, Andra K. Voges5, Corinna 10
N. Ross1,2, Ken Sayers1,2, Christopher Chen1,2, Cory Hallam2, Shabaana A. Khader4 , Makedonka 11
Mitreva4, Timothy J. C. Anderson2, Luis Martinez-Sobrido2, Jean L. Patterson2, Joanne Turner2, 12
Jordi B.Torrelles2, Edward J. Dick , Jr.1,2, Kathleen Brasky1,2, Larry S. Schlesinger1,2, Luis D. 13
Giavedoni1,2#, Ricardo Carrion, Jr.1,2#, Deepak Kaushal1,2#14
Affiliations: 1Southwest National Primate Research Center, 2Texas Biomedical Research Institute, 15
San Antonio, TX, 78227, 3Regeneron Pharmaceuticals, Inc., Tarrytown, NY 10591; 4Washington 16
University in St Louis School of Medicine, St Louis, MO; 5Veterinary Imaging Consulting of South 17
Texas, San Antonio, TX, 78258. 18
#To whom correspondence may be addressed: Deepak Kaushal, PhD, Director, Southwest 19
National Primate Research Center, Professor, Texas Biomedical Research Institute, 8715 W. 20
Military Drive, San Antonio, TX, 78227, Email: [email protected], Tel. (2 10)258 -9209; OR 21
Ricardo Carrion, Jr., PhD, Professor, Texas Biomedical Research Institute, 8715 W. Military Drive, 22 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148828
San Antonio, TX, 78227; Email: [email protected], Tel. (210)258 -9479 OR Luis D. Giavedoni, 23
PhD, Professor, Texas Biomedical Research Institute, 8715 W. Military Drive, San Antonio, TX, 24
78227, Email: [email protected], Tel. (210)258-9603. 25
Abbreviations: COVID-19, Coronavirus disease 2019; SARS-CoV-2, Severe Acute Respiratory 26
Syndrome Coronavirus-2; BAL, bronchoalveolar lavage; PFU, Plaque Forming Unit; CRP, C- 27
reactive protein; CXR, thoracic radiograph; NHP, nonhuman primate; PBMC, peripheral blood 28
mononuclear cell; dpi, days post-infection. 29
Key words : COVID-19, SARS-CoV-2, nonhuman primates, rhesus macaques, baboons, marmosets, 30
animal models, BAL, CT 31
32
Summary 33
There are no known cures or vaccines for COVID- 19, the defining pandemic of this era. Animal 34
models are essential to fast track new interventions and nonhuman primate (NHP) models of 35
other infectious diseases have proven extremely valuable. Here we compare SARS-CoV-2 36
infection in three species of exp erime ntally infected NHPs (rhesus macaques, baboons, and 37
marmosets). During the first 3 days, macaques developed clinical signatures of viral infection and 38
systemic inflammation, coupled with early evidence of viral replication and mil d-to-moderate 39
interstitial and alveolar pneumonitis, as well as extra-pulmonary pathologies. Cone-beam CT 40
scans showed evidence of moderate pneumonia, whi ch progressed over 3 days. Longitudinal 41
studies showed that whi le both young and old macaques dev eloped early signs of COVID-19, both 42
groups recovered within a two-week period. Recovery was characterized by low-levels of viral 43
persistence in the lung, suggesting mechanisms by which individuals with compromised immune 44 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148829
systems may be susceptible to prolonged and progressive COVID-19. The lung compartment 45
contained a complex early inflammatory milieu with an influx of innate and adaptive immune 46
cells , particularly interstitial macrophages, neutrophils and plasmacytoid dendritic cells, and a 47
prominent Type I-interferon response . While macaques developed moderate disease, baboons 48
exhibited prolonged shedding of virus and extensive pathology following infection; and 49
marmosets demonstrated a milder form of infection. These results showcase in critical detail, the 50
robust early cellular immune responses to SARS-CoV-2 infection, which are not sterilizing and 51
likely impact development of antibody responses. Thus, various NHP genera recapitulate 52
heterogeneous progression of COVID-19. Rhesus macaques and baboons develop different, 53
quantifiable disease attributes making them immediately available essential models to test new 54
vaccines and therapies. 55
56
Main 57
A novel coronavirus, designated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), 58
emerged in Wuhan, China in 2019, and was proven to be the cause of an unspecified pneumonia. 59
It has since spread globally, causing Coronavirus Disease 2019 (COVID-19) 1. The World Health 60
Organization (WHO) declared COVID-19 a pandemic. It is clear that community spread of SARS- 61
CoV-2 is occurring rapidly and the virus has very high infectivity and transmission rates, even 62
compared to SARS-CoV-1, the causative agent of an outbreak 15 years earlier. It has been 63
estimated that between up to 250,000 American lives may be lost due to COVID-19. The world 64
over, these numbers could be 10-50 times worse. Clearly, COVID-19 is the most defining 65 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148830
pandemic of this era, requir ing significant biomedical research input, in order to most effectively 66
fast track the development of new therapies and vaccines. 67
68
Human COVID-19 disease presents with a broad clinical spectrum ranging from asymptomatic to 69
mild and severe cases. Patients with COVID pneumonia exhibit high-grade pyrexia, fatigue, 70
dyspnea and dry cough accompanied by a rapidly progressing pneumonia, with bilateral opacities 71
on x-ray and patchy, ground glass opacities on lung Computed Tomography (CT) scans. Individuals 72
with immunocompromised conditions and comorbidities are at highest risk for worse outcomes 73
of COVID-19. 74
75
Nonhuman primate (NHP) models of infectious diseases have proven useful for both investigating 76
the pathogenesis of infection and testing therapeutic and vaccine candidates 2. During the SARS 77
and MERS outbreaks, NHP models were developed with a moderate degree of success3. Early 78
reports also indicate the utility of NHPs for SARS-CoV-2 infection, and for evaluating vaccine 79
candidates4,5,6,7. We hypothesized that the heterogeneity of human responses to SARS-CoV-2 80
infection can be recapitulated using multiple NHP species. Furthermore, we sought to gain a 81
detailed characterization of the early cellular immune events following SARS-CoV-2 infection in 82
the lung compartment, which has not yet been reported. Here, we compare SARS-CoV-2 infection 83
in three species of NHPs (Specific Pathogen-free [SPF] Indian rhesus macaques, African-origin 84
baboons, and N ew-World origin common marmosets). We assess age as a variable and focus our 85
studies on high resolution imaging and the critical nature of the early cellular immune response 86
in the lung which likely impacts disease outcome. 87 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148831
88
Early events in SARS-CoV-2 infection in rhesus macaques 89
We first assessed the ability of SARS-CoV-2 to infect rhesus macaques during an acute 3-day 90
infection study. Four Indian-origin mycobacteria- and SPF-naïve rhesus macaques (Macaca 91
mulatta) (Table S1) were infected by multiple routes (ocular, intratracheal and intranasal) with 92
sixth-passage virus at a target dose of 1.05x106 PFU/per animal. All animals developed clinical 93
signs of viral infection as evidenced by a doubling of serum C-Reactive Protein (CRP) levels 94
relative to baseline, indicating systemic inflammation (Fig 1 a); significantly decreased serum 95
albumin (Fig 1b) and hemoglobin (Fig 1c) levels, indicating viral-induced anemia; and 96
progressively increasing total serum CO 2 levels (Fig S1 a) indicative of pulmonary dysfunction. 97
These observations were accompanied by a decrease in red blood cells (RBCs) (Fig S1b), 98
reticulocytes (Fig S1 c), white blood cells (WBCs) (Fig S1d), and platelet counts (Fig S1e); and a 99
decrease in both the total number and percentage of neutrophils (Fig S1f, g), the latter suggesting 100
that neutrophils are recruited to the lung compartment in response to SARS-CoV-2 infection as 101
first responders. In contrast, systemic influx of monocytes was observed, indicating viral 102
infection-induced myelopoiesis (Fig S1 h). Monocytes are crucial for successful antiviral responses 103
via recognition of pathogen-associated molecular patterns, thereby initiating a signaling cascade 104
that invokes an interferon response to control infections. No significant pyrexia or weight loss 105
was observed in this acute study. Overall, our results suggest that rhesus macaques develop 106
several clinical signs of viral infection following experimental exposure to SARS-CoV-2. 107
108 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148832
Viral RNA was detected in BAL, and from nasal or nasopharyngeal (NS) and buccopharyngeal (BS) 109
swabs at 1-3 days post-infection (dpi), but not at pre-infection time points (Fig 1d-f). Vir al RNA 110
was also detected in saliva and from rectal swabs (RS) in a small subset of animals (Fig S 1i-j). 111
Unlike other samples, viral RNA was only detected in RS at later time points (i.e., after 1 dpi). At 112
necropsy (3 dpi), we performed random sampling from every lung lobe and SARS-CoV-2 RNA 113
could be detected in 23/24 total lung sections analyzed. An average of 4-6 log copies/100 mg of 114
lung tissue could be detected from every lobe (Fig 1g) . The ~4-log increase in viral RNA from 1 to 115
2 dpi in the BAL (Fig 1d) provided clear evidence of early active replication of SARS-CoV-2 in 116
rhesus macaques. 117
118
Examination at necropsy (3 dpi) revealed findings of interstitial and alveolar pneumonia (Fig 1h, 119
i). While gross appearance of the lungs of most infected animals was unremarkable (Fig S2a), 120
multifocal to coalescing red discoloration of the left lung lobes in one macaque was observed (Fig 121
S2b). Table S2 summarizes the histopathologic findings in descending order of occurrence by 122
anatomic location. The lung was the most affected organ ((Fig 1h, i, Table S2, Fig S2). Multifocal, 123
mild to moderate interstitial pneumonia characterized by infiltrates of neutrophils, macrophages, 124
lymphocytes, and eosinophils was present in all four animals (Fig 1 i, Fig S2d, e, g, h), and was 125
accompanied by variable fibrosis (4/4, Fig S2e), fibrin deposition (3/4, Fig S2c), vasculitis (3/4, Fig 126
S2f), edema (2/4, Fig S2h), necrosis (Fig S2g), and areas of consolidation (2/4, Fig S2c). All four 127
macaques exhibited the following: 1) Syncytial cells in the epithelial lining and/or alveolar lumen 128
(Fig S2e, g, k) ; 2) Bronchitis characterized by infiltrates of eosinophils within the bronchial wall 129 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148833
and epithelium (Fig 1h, Fig S2i, j, k); Bronchus -associated lymphoid tissue (BALT) hyperplasia (Fig 130
S2i); and 4) Minimal to moderate lymphoplasmacytic and eosinophilic tracheitis and rhinitis. 131
132
The presence of SARS-CoV-2 in tissue sections collected at necropsy (3 dpi) was determined by 133
multi-label confocal immunofluorescence using antibodies specific for Nucleocapsid (N) (Fig 1j, 134
k, Fig S3) and Spike (S) proteins (Fig S4) and their respective isotype controls (Fig S3, S4). 135
Fluorescence immuno-histochemical analysis revealed the presence of SARS CoV-2 proteins in 136
lungs (Fig 1j, Fig S3a, g, Fig S4a, d, g, j), nasal epithelium (Fig 1k, Fig S3b, h, Fig S4b, e, h, k) and 137
tonsils (Fig S3c, i, Fig S4c, f, I, l). In all tissues, including lungs (Fig 1j, Fig S3 a, g), nasal epithelium 138
(Fig 1k, Fig S3 b, h) and tonsils (Fig S3 c, i), N antigen signal was present in cells expressing ACE2, 139
which has been shown to be a receptor for SARS-CoV-2, or in cells adjoining those expressing 140
ACE2. No signal was detected in N isotype control staining in lungs, nasal epithelium or tonsils 141
(Fig S3d -f), and no signal for viral antigen was detected in naïve tissues (Fig S3 m, n). It appeared 142
that the expression levels of ACE2 protein w ere much lower in lung tissues derived from naïve 143
animals compared to those from macaques exposed to SARS-CoV-2 (Fig S3 m, n). The majority of 144
the S signal was detected in the epithelial layer with discrete distribution throughout the lung 145
tissue (Fig S4a, d). In the nasal cavity, the virus was observed in cells of the epithelial linings (Fig 146
S4b, h) but in tonsils, the virus appeared distributed throughout the tissue (Fig 3c, i). Together, 147
these results show that SARS-CoV-2 exposure induces a respiratory tract infection in rhesus 148
macaques. Viral replication is supported in the upper and lower lung compartments during the 149
first three days of infection and viral antigens are detected at high levels in the lungs. 150
151 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148834
To complement the lung histopathology in rhesus macaques, radiographs were performed at 152
baseline and each day post -infection. All four infected macaques showed progressi ve increase in 153
CXR abnormality scores, consistent with an infectious disease (Fig 2a, Fig S5a). The 2 and 3 dpi 154
CXR scores were significantly elevated relative to baseline (Fig 2a), despite evidence of partial 155
resolution of specific lesions at 2 or 3 dpi versus 1 dpi (Fig S5a). There were mild-to-severe 156
multifocal interstitial-to-alveolar patterns with soft tissue opacities (seen as ground glass 157
opacities described in the CT scans below) in various lobes or diffusely in some animals, with 158
more severe abnormalities in the lower lung lobes, and with the most severe findings at 3 dpi 159
(Fig S 5a). Pleural effusions were also observed. 160
161
Lung CT scans prior to infection showed a normal thorax cavity with the exception of atelectasis 162
(Fig 2b -d, top panel). Within 1 dpi, CT scans showed increased multifocal pulmonary infiltrates 163
with ground glass opacities in various lung lobes, linear opacities in the lung parenchyma, nodular 164
opacities in some lung lobes, and increased soft tissue attenuation extending primarily adjacent 165
to the vasculature (Fig 2c, Fig S 5b-e). In some animals, multifocal alveolar pulmonary patterns 166
and interstitial opacities were observed in lobe subsections, with soft tissue attenuation and focal 167
border effacement with the pulmonary vasculature. Features intensified at 2-3 dpi, primarily in 168
the lung periphery, but also adjacent to the primary bronchus and the vasculature (Fig 2d , Fig 169
S5b). In other animals, progressive alveolar or interstitial pulmonary patterns were observed at 170
2 dpi (Fig 2c). While ground glass opacities in some lobes intensified at 2 dpi relative to 1 dpi, 171
others resolved (Fig S5c, d). In one animal, the individual nodular pattern at 1 dpi evolved to a 172
multifocal soft tissue nodular pattern in multiple lobes with associated diffuse ground glass 173 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148835
opacities (Fig S 5d). At 3 dpi, persistent, patchy, fairly diffuse ground glass pulmonary opacities 174
existed in many lung lobes with multifocal nodular tendency (Fig S 5e). Overall, CT abnormality 175
scores continuously increased at over the 3 days relative to baseline (Fig 2e). Percent change in 176
the hyperdensity volume was calculated using CT scans to quantify pathological changes over the 177
course of disease 8. We observed a significant increase in lung hyperdense areas between 1-3 dpi 178
compared to the baseline scans (Fig 2f-i). Measurement of volume involved in hyperdensity 179
showed a significant, progressive increase over time (Fig 2j). Pneumonia was evident in all 180
infected animals relative to their baseline (Fig 2j), suggesting that while some lesions formed and 181
resolved within the three-day infection protocol, others persisted or progressed. Together, CXR 182
and CT scans revealed moderate multi-lobe pneumonia in infected animals, confirming the 183
histopathology results (Fig 1h, i, Fig S2) in the very early phase of SARS-CoV-2 infection in rhesus 184
macaques. 185
186
We measured the levels of pro-inflammatory, Type I cytokines in the BAL fluid (Fig 3) and plasma 187
(Fig S 6a-l) of acutely infected rhesus macaques. Levels of IL-6 (Fig 3a), IFN-a (Fig 3b), IFN-g (Fig 188
3c), IL-8 (Fig 3d), perforin (Fig 3e), IP-10 (Fig 3f), MIP1-a (Fig 3g) and MIP1-b (Fig 3h) were all 189
significantly elevated in the BAL fluid. The levels of IL-12p40 (Fig 3i), IL-18 (Fig 3j), TNF (Fig 3k) 190
and IL-1Ra (Fig 3l) increased over time. Of particular interest was the elevation of Type I IFN-a 191
(Fig 3b), which has critical anti-viral activity including against SARS-CoV-2 9. Expression of a 192
downstream Type-I interferon-regulated gene IP-10 (CXCL-10), which promotes the recruitment 193
of CXCR3+ Th1 thymocytes, was also induced (Fig 3f). Therefore, we observed that rhesus 194
macaques mount an early anti-viral response to SARS-CoV-2 infection. Type I IFNs and IL-6 (both 195 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148836
significantly expressed) are key compon ents of a “cytokine-storm” which promote acute 196
respiratory distress syndrome (ARDS) associated with both SARS-CoV-1 and -2, when induced 197
uncontrollably10. IFN-a and IP-10 were also significantly elevated in plasma samples at 2 and 3 198
dpi (Fig S6). 199
200
Thus, clinical, imaging, pathology and cytokine analyses provide evidence for an acute infection 201
in macaques following exposure to SARS-CoV-2, which leads to a moderate pneumonia and 202
pathology, with early activation of anti-viral responses. To study progression of infection, and 203
assess the effect of age on SARS-CoV-2 infection, we inf ected six young and six old Indian-origin 204
rhesus macaques as described above and longitudinally followed the outcome over 14-17 days 205
(Table S1). We included four macaques as procedural controls, which were sham-infected and 206
underwent all procedures (with the exception of necropsy) to control for the impact of multiple 207
procedures over the course of the study (Table S1). We also infected six baboons and an equal 208
number of marmosets with SARS-CoV-2 in order to compare the progression of COVID-19 in 209
different NHP models. 210
211
Long-term study of SARS-CoV-2 infection in rhesus macaques, baboons and marmosets 212
demonstrates heterogeneity in progression to COVID -19 213
Results of the longitudinal study showed that the acute signs of SARS-CoV-2 infection and mild- 214
to-moderate COVID-19 disease in rhesus macaques markedly improved over time (Fig S7). In 215
general, no major differences were observed as a consequence of age, and subsequent data from 216
young and old animals are combined (N=12), unless specified. A small subset (3/12) of animals 217 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148837
exhibited elevated serum CRP past 3 dpi (Fig S7a), although metabolic signs of dysfunction likely 218
induced by infection (e.g. tCO2 elevation) continued for the duration of the study (Fig S 7b). No 219
alterations were observed in the levels of serum albumin or hemoglobin during this timeframe 220
(not shown). There was a significant decline in RBCs (Fig S7c) at 3 and 6 dpi which normalized or 221
reverted by 9 dpi. The percentage of neutrophils in the peripheral blood remained unchanged 222
between 3-14 dpi (not shown). The significant decline in blood platelets and increase in the 223
percentage of monocytes observed at 3 dpi, were short-lived (Fig S7d, e). Despite these modest 224
changes, the majority of animals in both age groups exhibited weight loss throughout the study 225
duration (Fig S7f), although pyrexia was not observed (not shown). 226
227
Viral RNA was detected in BAL of 10/12 macaques at 3 dpi, but declined thereafter (Fig 4a). 228
Detection of viral RNA was equivalent between young (5/6) and old (5/6) macaques (Fig S8a). 229
Very low viral RNA copy numbers were detected in BAL at 9 dpi with only one young macaque 230
testing positive, and none by 12 dpi (Fig 4a). Viral RNA appeared to persist for much longer in NS 231
than BAL, including at study endpoint (Fig 4b). Viral RNA was detected from NS in 6/12 macaques 232
at 3 dpi and on average young macaques harbored more virus in their nasal cavity at 3 dpi relative 233
to old animals but the differences were not significant (Fig S8b). SARS-CoV-2 RNA was detected 234
in 10/12 macaques (6 young, 4 old, respectively) at 9 dpi and 6/12 macaques at the end of the 235
study period (Fig S 8b). These results suggest that the virus persists for at least two weeks in the 236
respiratory compartment of immunocompetent macaques that clinically recovered from COVID- 237
19. Viral RNA was detected from BS in 4/12 animals at 3 and 6 dpi, but not at later time points 238
(Fig S8c, d). No significant difference was detected between age groups. Viral RNA was also 239 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148838
detected from RS in 2/12 animals at 3, 6 and 9 dpi (Fig S8e, f). Significantly lower levels of viral 240
RNA (2.5 logs) were detectable at the end of the study (14-17 days) when c ompared to viral RNA 241
detected at the end of the 3-day protocol (Fig 4c, Fig S9a). Viral RNA was detected in the lungs of 242
two-thirds (8/12) of all macaques and no effect of age was apparent. No viral RNA was detected 243
in any serum samples (Fig S9b) or in randomly selected urine samples (Fig S9c). The presence of 244
viral RNA in the lungs of macaques after two weeks following recovery from acute COVID-19 245
indicates that while macaques control SARS-CoV-2 infection, immune responses are not 246
sterilizing. 247
248
Gross examination of the lungs of most infected animals at necropsy (14 to 17 dpi) was 249
unremarkable (Fig S10a); however, red discoloration of the dorsal aspect of the lung lobes was 250
seen in four young and two aged animals (Fig S10b). Table S3 summarizes the histopathologic 251
findings in descending order of occurrence by anatomic location. The lungs were the most 252
affected organ (Fig 4d, e, Table S3). Multifocal minimal to mild interstitial mononuclear 253
inflammation was seen in 11/12 animals (Fig 4n, 0, Fig S 10c), generally composed of macrophages 254
and lymphocytes that expanded the alveolar septa (Fig 4n, Fig S10d, e, f, g), with variable 255
neutrophil infiltrates (5/12, Fig S10e), fibrosis (5/12, Fig 4o, Fig S 10f, g) or vasculitis (3/12, Fig 256
S10i). Alveolar epithelium often contained areas of type II pneumocyte hyperplasia (4/12, Fig 257
S10e) and bronchiolization (2/12, Fig S 10h). Alveolar lumina contained increased alveolar 258
histiocytosis (9/12, Fig 4o, Fig S 10d, e) occasionally admixed with neutrophils (5/12, Fig S10e). 259
Syncytial cells (Fig S10e, f) were observed most frequently in the alveolar lumen in all 12 animals. 260
Bronchitis was observed in 4/12, characterized by infiltrates of eosinophils within the bronchial 261 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148839
wall and epithelium (Fig S10j). Prominent perivascular lymphocytes (7/12, Fig S10k) and BALT 262
hyperplasia (5/12, Fig S 10i) were frequently observed. The majority of the animals (11/12) 263
exhibited minimal to moderate lymphoplasmacytic and eosinophilic tracheitis. 264
265
Early detection of viral RNA in BAL was comparable between macaques and baboons (Fig 4a, f) 266
and NS (Fig 4b, g). A third of the baboons had detectable viral RNA in NS at 12 dpi (Fig 4g), and a 267
similar number of animals remained positive at 9 dpi in the BS (Fig S11a). The number of baboons 268
from which viral RNA could be detected in RS increased over time from 1/6 at 3 dpi to 3/6 at 6 269
dpi, 4/6 at 9 dpi and 3/6 at 12 dpi, underscoring long-term viral persistence of SARS-CoV-2 in 270
baboons relative to rhesus macaques (Fig S1 1b). Postmortem gross examination at 14 to 17 dpi 271
identified red discoloration of the lung lobes in all six baboons (Fig S11c, d). Table S4 summarizes 272
the histopathologic findings in descending order of occurrence by anatomic location. Like 273
macaques, the lungs were the most affected organ in the baboons (Fig 4h, i, Table S6, Fig S11). 274
Multifocal minimal to moderate interstitial mononuclear inflammation was seen in 6/6 animals 275
(Fig 4h, Fig S11f, g, h, i), generally composed of macrophages and lymphocytes that expanded 276
the alveolar septa, with variable neutrophil infiltrates (3/6, Fig S11f, g, j, k) or fibrosis (2/6, Fig 277
S11j, k). Alveolar epithelium often contained areas of type II pneumocyte hyperplasia (4/6, Fig 4i, 278
Fig S1 1i) and bronchiolization (1/6, Fig S1 1l). Alveolar lumina contained increased alveolar 279
histiocytosis (6/6, Fig 4h) occasionally admixed with neutrophils (3/6) (Fig S11f, g, h, i). Syncytial 280
cells were observed most frequently in the alveolar lumen in all 6 animals (Fig 4h, Fig S1 1m). 281
Bronchitis was observed in 6/6, characterized by infiltrates of eosinophils within the bronchial 282
wall and epithelium (Fig S11n). BALT hyperplasia (5/6, Fig S11k) was frequently observed. The 283 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148840
majority of the animals exhibited minimal to moderate lymphoplasmacytic and eosinophilic 284
tracheitis (5/6) and rhinitis (4/6). 285
286
SARS-CoV-2 infection was milder in marmosets. Less than 4 logs of viral RNA could be detected 287
in NS from infected marmosets, peaking at 3 dpi, and 1/6 animals was also positive at 6 dpi. N o 288
viral RNA was detected at later time points (Fig 4j). No viral RNA was detected in BS (Fig 4k). A 289
subset of six marmosets was euthanized at 3 dpi (n=2), while others were necropsied at 14 dpi. 290
Approximately 2 logs of viral RNA could be detected in the lungs of marmosets at both time 291
points. Evidence of SARS-CoV-2 infection-induced pathology, including interstitial and alveolar 292
pneumonitis was observed in marmoset lungs as well (Fig 4m, n), although not as prevalent as in 293
macaques or baboons. Thus, our results show that three genera of NHPs develop different 294
degrees of COVID-19 following SARS-CoV-2 infection when evaluated side by side, with baboons 295
exhibiting moderate to severe pathology, macaques exhibiting moderate pathology and 296
marmosets exhibiting mild pathology. Viral RNA levels in BAL, NS and lungs are consistent with 297
the levels of pathology. While other results also suggest that marmosets are unaffected by SARS- 298
CoV-2 infection 4 (https://www.biorxiv.org/content/10.1101/2020.03.21.001628v1 ), we show 299
that these NHPs do de velop non-negligible, mild COVID-19-related pathology and some degree 300
of viral persistence. 301
302
We performed detailed imaging of macaques in the longitudinal study. Similar to the acute study, 303
imaging revealed the development of viral pneumonia. All macaques infected with SARS-CoV-2 304
exhibited low baseline CXR scores (Fig 5a, Table S5) with no difference due to age (Fig 5b). Several 305 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148841
infected macaques showed changes consistent with pneumonia (Table S5) with peak severity 306
seen between 3-6 dpi, followed by a decline by study end (Fig 5a, b, Table S5). Examples of the 307
development of extensive pneumonia by CXR can be seen in macaques at 6 dpi, relative to 308
baseline with subsequent resolution (Fig 5 c-e). Several animals exhibited multi-lobe alveolar 309
infiltrates and/or interstitial opacities at 6 dpi. In other animals, there were progressive, 310
mode rate to severe interstitial and alveolar infiltrates at 6 dpi, which resolved by day 14. 311
Conversely, the radiographs of all procedure control animals (which underwent repeated BAL 312
procedures) exhibited normal a thorax cavity with minimal to no findings. 313
314
High resolution CT imaging of the lungs was performed prior to and following SARS-CoV-2 315
infection on six young and six old macaques. Pneumonia was present in all animals, post - 316
infection, but to a significantly higher degree in old macaques relative to young (Fig 5f, Fig S1 2a- 317
f, Table S6). At 6 dpi, severe patchy alveolar patterns were observed in some lobes, while other 318
lobes had milder, interstitial patterns, with moderate to severe ground glass opacities primarily 319
in the lungs of old macaques (Fig S12a-f). In all animals, resolution of many ground glass opacities 320
and nodular as well as multifocal lesions was observed at 12 dpi (Fig 5f, Fig S12a, b, d-f). At 12 321
dpi, all but one of the older macaques exhibited a normal or nearly normal thorax cavity, the 322
latter with minimal ground glass opacities in all lung lobes studied at this time . Findings in one 323
older macaque was considerably improved but retained patchy round glass opacities in all lobes 324
and alveolar patterns in some lobes at 12 dpi (Fig S1 2c). This animal had the highest overall score 325
by CT (Fig 5f) and CXRs (Fig 5 a-b). These results suggest that pneumonia in some older macaques 326
may persist longer than in younger animals. Similar to the acute study, hyperdensity analysis 327 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148842
revealed a significant, progressive increase in the volume of lung involved in pneumonia at 6 dpi, 328
which normalized by 12 dpi (Fig 5g-o). 329
330
SARS-CoV-2 infection in macaques results in a dynamic myeloid cell response in the lungs of 331
rhesus macaques 332
Cellular composition in BAL samples and peripheral blood11,12 at necropsy showed markedly 333
altered immune cell responses in the lung compartment following infection of macaques. In 334
healthy lungs, BAL is predominantly comprised of alveolar macrophages (AMs)13 but respiratory 335
tract infections result in the influx of other immune cells. SARS-CoV-2 infection moderately 336
increased the proportions of myeloid cells in the BAL 3 dpi, with most returning to normal by 9 337
dpi (Fig S1 3a). There was no effect of age (Fig S 13b). The myeloid influx included cells phenotyped 338
as interstitial macrophages (IMs, Fig 6a, e), neutrophils (Fig 6c, g) and plasmacytoid dendritic cells 339
(pDCs, Fig 6d, h). In contrast, the levels of resident AMs in BAL declined significantly at 3 dpi (Fig 340
6b, f). The increase in IMs, neutrophils and pDCs at 3 dpi was highly correlated with the levels of 341
viral RNA (Fig 6i-j, Fig S13i), while AMs exhibited an opposite trend. The frequency of 342
conventional dendritic cells (cDCs) declined as pDCs increased in BAL (Fig S1 3c). An increase in 343
the levels of both classical (CD14+CD16-) (not shown) and intermediate/inflammatory 344
(CD14+CD16+) monocytes in BAL was also observed at 3 dpi (Fig S13d). The frequency of myeloid 345
subpopulations increased in BAL was generally reduced in blood (Fig S13e-h), with two 346
exceptions - pDCs and CD14+CD16+ monocytes, which were increased in the blood as well as BAL 347
(Fig S1 3g-h). Relative to AMs, IMs have a shorter half-life, exhibit continuous turnover, and may 348
help to maintain homeostasis and protect against continuous pathogen exposure from the 349 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148843
environment14. Increased recruitment of pDCs to the lungs suggests a potentially important 350
feature of protection from advanced COVID-19 disease in the rhesus macaque model since they 351
are a major source of anti-viral Type I interferons such as IFN-a, the levels of which were elevated 352
in the BAL within 1-3 dpi (Fig 3 b). 353
354
Multi-label confocal imaging of lung tissues following Ki67 staining depicted that only few of the 355
virally-infected cells in the lung tissue actively proliferated (Fig 5k-p). Detailed analysis of the lung 356
tissue revealed that neutrophils (Fig 6 k, l, Fig S14a, d), macrophages (Fig 6 m, n , Fig S14b, h) and 357
pDCs (Fig 6 o, p, Fig S1 4c, i) recruited to the lung compartment (Fig 6a-h) harbored high levels of 358
viral proteins (Fig 6k-p, Fig S14). Apart from these, many of the other cell-types contained viral 359
proteins, suggesting a capacity of the virus to infect many cell types and that intact virus may also 360
persist in the lungs. These novel data suggest that rapid influx of specialized subsets of myeloid 361
cells to the lung that are known to express Type I IFNs and other pro-inflammatory cytokines is a 362
key event in the control of SARS-CoV-2 infection. 363
364
Infection of macaques also resulted in a significant influx of T cells to the alveolar space by 3 dpi, 365
which normalized by 9 dpi (Fig 7a, b, g). After infection, CD4+ T cells expressed significantly lower 366
levels of antigen-experience/tissue residence (CD69 ; Fig 6c), Th1 (CXCR3; Fig 6d), memory (CCR7; 367
Fig 6f), and activation (HLA-DR) (Fig 6m) markers in BAL. In contrast, the levels of CD4+ T cells 368
expressing PD -1 (Fig 6e) and LAG-3 (Fig 6n) were significantly elevated, while those of CD4+ T cells 369
expressing CCR5 (Fig 6l) were unchanged. A similar effect was observed in CD8+ T cell subsets, 370
where the expression of CD69 (Fig 6h), CXCR3 (Fig 6i), and CCR7 (Fig 6k) was significantly reduced 371 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148844
in BAL following infection whereas expression of PD -1 (Fig 6j) and LAG-3 (Fig 6q) in the CD8+ T 372
cells was significantly increased. CCR5 (Fig 6o) and HLA-DR (Fig 6p) were unchanged. No 373
differences were observed in T cell responses in young relative to old animals. Taking data from 374
myeloid cells and lymphocytes together, we postulate that the rapid influx of myeloid cells 375
capable of producing high levels of Type I IFNs result in immune control of SARS-CoV-2 infection 376
in macaques, but that this control is not sterilizing. This allows for viral antigens to persist leading 377
T cell recruitment, but with a T cell profile associated with immune modulation and promotion 378
of antigen-mediated T cell anergy/exhaustion (PD-1, LAG3 expression)15. 379
380
To extrapolate from phenotype to function, we explored proliferation, immune mediator 381
production, and memory phenotypes. CD4+ and CD8+ T cells e xhibit ing proliferative (Fig 8a, g) 382
and memory markers (Fig 8b, h) were significantly increased in BAL after infection whereas CD4+ 383
and CD8+ T cells expressing naïve (Fig 8c, i) and effector (Fig 8d, j) phenotypes were significantly 384
reduced. The percentage of CD4+ (Fig 8e) and CD8+ (Fig 8k) T cells expressing IL-2 was significantly 385
elevated in the BAL at 9 dpi. A similar effect was observed for Granzyme-B (GZMB) (Fig 8f, l) which 386
was sustained through 9 dpi. No significant effect of age was observed, although the expression 387
of IL-2 on T cells was higher for young compared old rhesus macaques. Frequencies of CD4+ and 388
CD8+ expressing interferon-g (IFNG) (Fig S1 5a, d) and IL-17 (Fig S15b, e) were elevated, but 389
unchanged for TNF-a (Fig S 15c, f). Greater expression of IFNg was measured on CD4+ T cells 390
recruited to the BAL in younger animals, but the differences were not statistically significant. 391
These results suggest that robust cellular immune responses (both CD4+ and CD8+ T cells) are 392
generated in the lung compartment (BAL) as early as day 3 and maintained at 9 dpi in many 393 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148845
instances. Following e x vivo re-stimulation of T cells from BAL at 9 dpi with CoV-specific peptide 394
pools, CD4+ T cells expressing IL-2 (Fig 8m), GZMB (Fig 8n), IFN-g (Fig S1 5g), IL-17 (Fig S15h) and 395
TNF-a (Fig S1 5i) were not statistically elevated beyond baseline values. This was similar for CD8+ 396
T cells expressing IL-2 (Fig 8o), GZMB (Fig 8p), IFN-g (Fig S1 5j), IL-17 (Fig S15k) and TNF-a (Fig 397
S15l). In combination with increased expression of the immune-regulatory markers PD-1 and 398
LAG-3, our results suggest that T cells recruited to the lung compartment following SARS-CoV-2 399
infection are capable of secreting cytokine but fail to generate robust antigen specific responses 400
highlighting the fact that persist ent T cell stimulation by viral antigens may generate T cell anergy 401
relatively early in infection and this is promoted by our findings of viral persistence in the 402
respiratory tract. 403
404
Immunophenotyping results were confirmed by studying cytokine production in BAL and plasma 405
(Fig S1 6)16. Our results show that the levels of IFN-a (Fig S1 6a), IL-1Ra (Fig S1 6b), and IL-6 (Fig 406
S16d) were elevated in BAL following infection, but levels rapidly normalized after the 3 dpi peak . 407
Levels of IFN-a were also induced in plasma (Fig S16g), but not those of IL-1Ra (Fig S16h), and IL- 408
6 (Fig S1 6j) or other cytokines studied. Cytokines were not induced at baseline or in procedure 409
control animals. Overall, the longitudinal study results were consistent with the acute infection 410
study in the expression of Type I pro-inflammatory cytokines responsible for viral control (IFN-a) 411
and expression of IL-6, which may contribute to a cytokine storm and development of ARDS in a 412
subset of hosts during COVID-19. 413
414 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148846
Protein levels of ACE-2, one presumed receptor for SARS-CoV-2 in humans, were detected at 415
higher levels in the lungs and nasal epithelia of infected macaques than those in the lungs of 416
naive rhesus macaques (Fig 1j, k). Using RNAseq we also studied if expression of ACE-2 could be 417
detected in macaque lung tissues and elevated in in SARS-CoV-2 infected animals. This was 418
indeed the case (Fig S17a-d) in a statistically significant manner two weeks after infection despite 419
multiple hypothesis correction (Fig S17a, b). Interestingly, ACE-2 expression was significantly 420
higher in young compared to old macaques (Fig S17c, d). These results potentially explain the 421
higher levels of virus that we observed in several samples derived from young macaques in these 422
two cohorts (Fig S8). Expression of transcripts specific for other viral receptors/co-receptors e.g., 423
Cathepsin-L, CD147 or TMPRSS2 was not significantly altered in the lung two weeks after 424
infection (Fig S17a). 425
426
Altogether, our results show that rhesus macaques, baboons and marmosets can all be infected 427
with SARS-CoV-2 but exhibit differential progression to COVID-19. While marmosets exhibit mild 428
infection, macaques are characterized by the presence of moderate progressive pneumonia that 429
is rapidly resolved. This is accompanied by a marked reduction in lung and nasal viral loads. 430
Baboons appear to have the most lung pathology, and the level of viral shedding and persistence 431
in extra-respiratory compartment is also greater in this model. Furthermore, we show the 432
importance of state-of-the-art, non-invasive imaging – cone beam CT scanning, and the 433
application of innovative algorithms to identify the extent of lung involved in pneumonia, in 434
developing models of COVID-19. This provided us with a quantifiable metric that lent itself to 435
accurately assessing the efficacy of vaccines or the impact of therapeutic interventions. 436 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148847
437
Our results also point out, for the first time, that SARS-CoV-2 infection is associated with dynamic 438
influxes of specific subsets of myeloid cells to the lung, particularly IMs, neutrophils and pDCs, 439
and that viral proteins can be detected in these cells . These cellular influxes are likely due to a 440
strong viral-induced myelopoeisis. This may help explain both development of COVID-19 441
pneumonia and subsequent control via expression of a strong Type I IFN response and expression 442
of other pro-inflammatory cytokines. We speculate that these responses clear the majority of 443
virus, and, in doing so , lead to eventual resolution of pneumonia, while limiting a progressive 444
cytokine storm and ARDS in the majority of hosts. Macaques have served as excellent models of 445
infectious diseases and vaccine development efforts17-19, and this model permits lung imaging 446
and detailed immune evaluations. Given the ability to reproducibly measure viral loads in NS and 447
BAL, and quantify lung involvement by CT scans and hyperdensity analyses, we expect this model 448
to play a critical role in the preclinical testing of novel candidate vaccines against SARS-CoV-2 449
infection and/or COVID-19 disease in development . Experiments in rhesus macaques can also 450
evaluate safety and immunogenicity, including the important issue of antibody-mediated 451
immune enhancement. Since mild-to-moderate COVID-19 disease that follows SARS-CoV-2 452
infection in rhesus macaques is short-lived, it follows that vaccine safety and efficacy studies can 453
be evaluated in short term studies. 454
455
However, detection of both virus and its protein antigens over two weeks in macaques, baboons 456
and even marmosets, indicates viral persistence rather than sterilizing immunity . Support for this 457
comes from the finding of PD-1 and LAG-3 expression by CD4+ and CD8+ T cells in the lung and 458 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148848
lack of induction of antigen-specific immune effector cytokine production by these cells. 459
Characterization of these responses is particularly important considering that T cell responses, 460
particularly T helper responses, play key roles in shaping the nature of downstream B cell 461
responses and production of antibodies. It is likely that in immunocompromised patients, 462
persistent presence of SARS-CoV-2 could lead to exacerbated disease. Since COVID-19 has 463
disproportionately affected the aging human population, we included age as an independent 464
variable in our studies. Although there were several smaller changes observed in older animals, 465
old and young animals both resolved infection. While it is possible that NHPs do not completely 466
model all aspects of COVID-19 in humans, these findings suggest that underlying conditions which 467
impact immunity such as defined and undefined co-morbidities, rather than aging per se, may be 468
responsi ble for the greater morbidity and mortality observed due to COVID-19 in the aged human 469
population (and a subset of younger individuals). Baboons developed more extensive disease and 470
pathology with more widespread and severe inflammatory lesions compared to rhesus 471
macaques. Baboons are also a preferred model of cardiovascular and metabolic diseases 472
including diabetes 20-22, and therefore further development of the baboon model may prove 473
especially useful for the study of co-morbidities with COVID-19 such as diabetes, cardiovascular 474
disease, and aging. 475
476
Methods 477
478
Study approval. All of the infected animals were housed in Animal Biosafety Level 3 or 4 (ABSL3, 479
ABSL4) at the Southwest National Primate Research Center where they were treated per the 480 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148849
standards recommended by AAALAC International and the NIH Guide for the Care and Use of 481
Laboratory Animals. Sham controls were housed in ABSL2. The animal studies in each of the 482
species were approved by the Animal Care and Use Committee of the Texas Biomedical Research 483
Institute and as an omnibus Biosafety Committee protocol. 484
485
Animal studies and clinical evaluations. 16 (eight young and eight young , see Table S1 for details) 486
Indian-origin rhesus macaques (Macaca mulatta), and six African-origin baboons (Papio 487
hamadryas) all from SNPRC breeding colonies, were exposed via multiple routes (ocular, 100 µL; 488
intranasal, 200 µL - using a Teleflex Intranasal Mucosal Atomization Device; intratracheal, 200 µL 489
- using a Teleflex Laryngo-Tracheal Mucosal Atomization Device) of inoculation to 500 µL of an 490
undiluted stock of SARS-CoV-2, which had a titer of 2.1E+06 pfu/mL, resulting in the 491
administration of 1.05x106 pfu SARS-CoV-2. SARS-CoV-2 generated from isolate USA-WA1/2020 492
was used for animal exposures. A fourth cell-culture passage (P4) of SARS-CoV-2 was obtained 493
from Biodefense and Emerging Infections Research Resources Repository (BEI Resources, catalog 494
number NR-52281, GenBank accession number MN985325.1) and propagated at Texas Biomed. 495
The stock virus was passaged for a fifth time in Vero E6 cells at a multiplicity of infection (MOI) 496
of approximately 0.001. This master stock was used to generate a sixth cell culture passage 497
exposure stock by infecting VeroE6 cells at a MOI of 0.02. The resulting stock had a titer of 2.10 498
x 106 PFU/mL and was attributed the Lot No. 20200320. The exposure stock has been confirmed 499
to be SARS-CoV-2 by deep sequencing and was identical to published sequence (MN985325). 500
strain USA-WA1/2020 (BEI Resources, NR-52281, Manassas, VA). Six Brazilian-origin common 501
marmosets (Callithrix jacchus) were also infected via the combined routes (80µL intranasal; 40µL 502 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148850
ocular [20µL/eye]; 40µL oral performed twice for a total of 160µL intranasal, 80µL ocular; 80µL 503
oral and 100µL IT) of the same stock. The total target dose presented to marmosets was 8.82E+05 504
pfu/mL. Four macaques, baboons and marmosets each were sham-infected with DMEM-10 505
media (the storage vehicle of the virus), to be used as procedural controls. Infected animals were 506
euthanized for tissue collection at necropsy, and control animals were returned to the colony. 507
Macaques were enrolled from a specific pathogen-free colony maintained at the SNPRC and were 508
tested free from SPF-4 (simian retrovirus D, SIV, STLV-1 and herpes B virus). All animals including 509
the baboons and the marmosets were also free of Mycobacterium tuberculosis. Animals were 510
monitored regularly by a board-certified veterinary clinician for rectal body temperature, weight 511
and physical examination. Collection of blood, BAL, nasal swab, and urine, under tiletamine- 512
zolazepam (Telazol) anesthesia was performed as described (Table S1), except that BAL was not 513
performed in marmosets. Four macaques were sampled daily until euthanized at 3dpi. All other 514
macaques and all the baboons were sampled at 0, 3, 6, 9, 12 dpi and at euthanasia (BAL 515
performed weekly). Blood was collected for complete blood cell analysis and specialized serum 516
chemistries. Animals were observed daily to record alert clinical measurements. Nasal 517
(longitudinal) or nasopharyngeal (acute) swabs and BALs were obtained to measure viral loads in 518
a longitudinal manner , as described earlier 11. Briefly, in a sitting position, the larynx was 519
visualized and a sterile feeding tube inserted into the trachea and advanced until met with 520
resistance. Up to 80ml of warm sterile saline was instilled, divided into multiple aliquots. Fluid 521
was aspirated and collected for analysis. 522
Chest X-Rays. Clinical radiographic evaluation was performed as following: The lungs of all 523
animals were imaged by conventional (chest radiography, CXR), as previously described 23. Three 524 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148851
view thoracic radiographs (ventrodorsal, right and left lateral) were performed at all sampling 525
time points. High-resolution computed tomography (CT) was performed daily through 3 dpi in 4 526
infected macaques and on 6 and 12 dpi in 3 young and 3 old macaques as described in the next 527
section. Images were evaluated by a board-certified veterinary radiologist and scored as normal, 528
mild moderate or severe disease. The changes were characterized as to location (lung lobe) and 529
distribution (perivascular/peribronchial, hilar, peripheral, diffuse, multifocal/patchy). 530
CT Imaging and quantitative analysis of lung pathology . The animals were anesthetized using 531
Telazol (2-6mg/kg) and maintained by inhaled isoflurane delivered through Hallowell 2002 532
ventilator anesthesia system (Hallowell, Pittsfield, MA). Animals were intubated to perform end- 533
inspiratory breath-hold using a remote breath-hold switch. Lung field CT images were acquired 534
using Multiscan LFER150 PET/CT (MEDISO Inc., Budapest, Hungary) scanner. Image analysis was 535
performed using 3D ROI tools available in Vivoquant (Invicro, Boston, MA). Percent change in 536
lung hyperdensity was calculated to quantify lung pathology (1, 2). The lung volume involved in 537
pneumonia, was quantified as follows: briefly, lung segmentation was performed using a 538
connected thresholding feature, to identify lung ROI by classifying all the input voxels of scan in 539
the range of -850 HU to -500 HU. Smoothing filters were used to reassign every ROI voxel value 540
to the mode of the surrounding region with defined voxel radius and iterations to reconstruct 541
the Lung ROI. Thereafter, global thresholding was applied to classify the voxels within Lung ROI 542
in the range of -490 HU to +500 HU to obtain Lung hyperdensity ROI. The resultant ROIs were 543
then rendered in the maximum intensity projection view using the VTK feature. 544
545 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148852
Viral RNA determination . Viral RNA from plasma/sera, BAL, urine, saliva, and swabs 546
(nasal/nasopharyngeal, oropharyngeal, rectal) and lung homogenates was determined by RT- 547
qPCR and viral RNA isolation as previously described for MERS-CoV and SARS-CoV (12, 27, 28). 548
RNA extraction from fluids was performed using the EpMotion M5073c Liquid Handler 549
(Eppendorf) and the NucleoMag Pathogen kit (Macherey-Nagel). 100 µL of test sample were 550
mixed with 150 µL of 1X DPBS (Gibco) and 750 µL TRIzol LS. Inactivation controls were prepared 551
with each batch of samples to ensure no cross contamination occurred during inactivation. 552
Samples were thawed at room temperature and then, for serum, swabs and urine sampl es 10µg 553
yeast tRNA was added, along with 1 x 103 pfu of MS2 phage (Escherichia coli bacteriophage MS2, 554
ATCC). DNA LoBind Tubes (Eppendorf) were prepared with 20 µL of NucleoMag B-Beads 555
(NucleoMag Pathogen kit, Macherey-Nagel) and 975 µL of Buffer NPB2 (NucleoMag Pathogen kit, 556
Macherey-Nagel). After centrifugation, the upper aqueous phase of each sample was transferred 557
to the corresponding new tube containing NucleoMag B-Beads and Buffer NPB2. The samples 558
were mixed using HulaMixer (Thermo Fisher Scientific Inc.) rotating for 10 min at room 559
temperature. Samples were then transferred to the sample rack on EpMotion M5073c Liquid 560
Handler (Eppendorf) for further processing according to NucleoMag Pathogen kit instructions . 561
For viral RNA determination from tissues, 100mg of tissue was homogenized in 1mL Trizol 562
Reagent (Invitrogen, Grand Island, NY, USA) with a Qiagen (Germantown, MD, USA) steel bead 563
and Qiagen Stratagene TissueLyser. For detection of infectious virus, briefly, tissues were 564
homogenized 10% w/v in viral transport medium using Polytron PT2100 tissue grinders 565
(Kinematica). After low-speed centrifugation, the homogenates were frozen at −70°C until they 566
were inoculated on Vero E6 cell cultures in 10-fold serial dilutions. The SARS-CoV-2 RT-qPCR was 567 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148853
performed using a CDC-developed 2019 -nCoV_N1 assay with the TaqPath™ 1-Step RT-qPCR 568
Master Mix, CG (ThermoFisher). The assays were performed on a QuantStudio 3 instrument 569
(Applied Biosystems) with the following cycling parameters: Hold stage 2 min at 25°C, 15 min at 570
50°C, 2 min at 95°C. PCR stage 45 cycles of 3 s at 95°C, 30 s at 60°C. Primer and probe info: 2019- 571
nCoV_N1-F: GACCCCAAAATCAGCGAAAT (500nM); 2019-nCoV_N1-R: 572
TCTGGTTACTGCCAGTTGAATCTG (500 nM); 2019-nCoV_N1-P FAM/MGB probe: 573
ACCCCGCATTACGTTTGGTGGACC (125nM ). 574
575
Pathology . Animals were euthanized and complete necropsy was performed. Gross images (lung, 576
spleen, liver) and organ weights (lymph nodes, tonsil, spleen, lung, liver, adrenal glands) were 577
obtained at necropsy. Representative samples of lung lymph nodes (inguinal, axillary, mandibular 578
and mediastinal), tonsil, thyroid gland, trachea, heart, spleen, liver, kidney, adrenal gland, 579
digestive system (stomach, duodenum, jejunum, ileum, colon, and rectum), testes or ovary, 580
brain, eye, nasal tissue, and skin were collected for all animals. Tissues were fixed in 10% neutral 581
buffered formalin, processed to paraffin, sectioned at 5 um thickness, stained with hematoxylin 582
and eosin utilizing standard methods, and evaluated by a board-certified veterinary pathologist. 583
584
Tissue processing , flow cytometry, multiplex cytokine analyses, immunohistochemistry, 585
multicolor confocal microscopy and RNAseq for immune evaluations . 586
Flow cytometry was performed as previously described 24-26 on blood and BAL samples collected 587
on time points days 3, 6, 9, 12, and at endpoint, which occurred at 14-17 dpi for various animals. 588
A comprehensive list of antibodies used in these experiments is provided in Table S7. For 589 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148854
evaluations on peripheral blood, PBMC were prepared as previously described. Briefly, Cellular 590
phenotypes were studied using antibodies: CD3 (clone SP34-2), CD4 (clo ne L200), CD69 (clone 591
FN50), CD20 (2H7), CD95 (clone DX2), KI67 (B56), CCR5 (3A9), CCR7(clone 3D12), CD28 (clone 592
CD28.2), CD45 (clone D058 -1283), CXCR3 (clone 1C6/CXCR3), HLA-DR (clone L243), CCR6 (clone 593
11A9), LAG-3 (Polyclonal, R&D Systems, Minneapolis, MN, USA), CD123 (clone 7G3), CD14 (clone 594
M5E2), CD206 (clone 206), CD16 (clone 3G8), CD163 (GHI/61), CD66abce (Clone TET2, Miltenyi 595
Biotech, USA), CD40 (clone 5C3), IL-2(clone MQ1-17H12) , Granzyme-B (clone GB11) all 596
purchased from BD Biosciences (San Jose, CA, USA) unless specified. CD8 (clone RPA-T8), CD11c 597
(clone 3.9), TNF -alpha (clone MAb11), IFN-gamma (clone B27), IL-17 (clone BL168) and PD-1 598
(clone EH12.2H7) were purchased from BioLegend, San Diego, CA, US. For antigenic stimulation 599
cells were cultured overnight with SARS-CoV-2 specific peptide pools of the nucleocapsid (N), 600
membrane (M) and spike (S) proteins (PepTivator SARS-CoV-2 peptide pool, Miltenyi Biotech, 601
USA). A detailed gating strategy for detection and enumeration of various cellular phenotypes is 602
described (Fig S18). 603
604
Immuno-histochemistry was performed on 4 µm thick sections of lung, nasal cavity and tonsils. 605
The sections were baked at 650C for 30 min follo wed by de -paraffinization using Xylene and 606
subsequent hydration with decreasing gradations of ethanol as described 11,27. Heat induced 607
antigen retrieval was performed using Sodium citrate buffer (10mM, pH 6.0) followed by blocking 608
(3 % BSA in TBST for 1 h at 370C). For SARS CoV-2 detection, specimens were incubated with 609
rabbit SARS CoV-2 spike (S) antibody (ProSci, USA, 1:200, 370C for 2 h) or anti-SARS CoV-2 610
nucleocapsid (N) antibody (Sino Biologicals, USA, 1:100, 2h at 370C). Antihuman ACE-2 (R&D 611
Systems, USA, 1:50, 2h at 370C) was used for identification of ACE-2. Mouse anti-human 612 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148855
CD66abce-PE conjugated (Miltenyi Biotech, USA, 1:20, 2 h at 370C) was used for identification of 613
neutrophils; mouse CD68 (Thermo Fisher Scientific, USA, 1:100, 2 h at 370C) for macrophages and 614
pDC’s were identified by co-staining of PE conjugated mouse anti-human CD123 (BD Biosciences, 615
USA, 1:20, 370C for 2h) and mouse anti-human HLA-DR antibody (Thermo Fisher Scientific, USA, 616
1:100, 2 h at 370C). Also, mouse anti-Ki67 (BD Biosciences, USA, 1:50, 2 h at 370C) was used for 617
detection of actively proliferating cells. Chicken anti-rabbit IgG (H+L), Alexa Fluor 488 conjugate; 618
goat anti-mouse IgG (H+L), Alexa Fluor 647 conjugate; donkey anti-mouse IgG (H+L), Alexa-Fluor 619
555 conjugate secondary antibodies (Thermo Fisher Scientific, USA, 1:400, 1 h at 370C) were used 620
for labelling Spike, Ki67 and HLA-DR, CD68 primary antibodies respectively. Tissue sections were 621
then stained with DAPI (Thermo Fisher Scientific, USA, 1:5000, 5 min at 370C) with subsequent 622
mounting with Prolong Diamond Antifade mountant (Thermo Fisher Scientific, USA). Ziess LSM 623
800 confocal microscope was used to visualize the stained sections (10X, 20X and 63X 624
magnification). 625
626
RNA was isolated, RNAseq performed and data analyzed as described 16. 627
628
629
Statistical analyses . Statistical analyses . Graphs were prepared and statistical comparisons 630
applied using GraphPad Prism version 8 (La Jolla, CA). Various statistical comparisons were 631
performed viz. 2-tailed Student’s t-test, ordinary analysis of variance (ANOVA) or one-way or two- 632
way repeated measure analysis of variance (rmANOVA) with Geisser-Greenhouse correction for 633
sphericity and Tukey’s post hoc correction for multiple-testing (GraphPad Prism 8) was applied 634
wherev er applicable and as described in the figure legends. For Correlation analysis, Spearman’s 635 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148856
rank test was applied. Statistical differences between groups were reported significant when the 636
p-value is less than or equal to 0.05. The data are presented in mean ± SEM. 637
638
Author Contributions. DK, LSS, RC, LDG designed these studies. DKS, SRG, BS, JC, KJA, RE, T-HL, 639
MG, YG-G, RS, AC, RT, MG, CA, AB, JF, CB, HS, LP, JC, AM, BK, RNP, PE, VH, XA, AB, CK, MA, BR 640
conducted the experiments and acquired the data. EC, AG, JD, SH-U, PAF, CNR, KS, CC, CH, OG, 641
JD, AKV, CH, EJD and KB provided veterinary, veterinary pathology, imaging, colony management 642
or management expertise; DKS, SRG, BS, KJA, AC, MG, EC, RNP, JS, AO, DKA, RC, BR, TJCA, SAK, 643
MM, LDG, RC and DK analyzed the data; DK wrote the paper; LSS, JT, LDG, RC, JBT, KB, EC, LMS, 644
JLP, SG and DKS provided assistance with writing the paper. 645
646
Acknowledgments. We acknowledge exceptional work by our SNPRC veterinary technical and 647
care staff (especially the veterinary technical/animal care groups headed by Tyneshia Camp, 648
Wade Hodgkins, Manuel Aguilar, David Vandenberg and Laura Rumpf) as well as the entire SNPRC 649
and Texas Biomed administrative staff, especially Helen Hawn, for assistance with this study , 650
especially during trying times. 651
652
Statement on conflict of interests: “RC, Jr is funded by Regeneron, Inc. This funder had no role, 653
however, in the design and execution of the experiments and the interpretation of data. The 654
authors declare that no other financial conflict of interest exists.” 655
656 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148857
Financial support. This work was primarily supported by a philanthropic award to Texas Biomed 657
Coronavirus Working Group; a SNPRC Pilot study award to LDG, RC, JP, LM and JBT; an award to 658
RC, Jr from Regeneron Pharmaceuticals, (contract # 2020_004110) in part with federal funds from 659
the Department of Health and Human Services; Office of the Assistant Secretary for Preparedness 660
and Response; Biomedical Advanced Research and Development Authority, under Contract No. 661
HHSO100201700020C; and institutional NIH awards P51OD111033 and U42OD010442. The 662
views expressed here are those of the authors and do not necessarily represent the views or 663
official position of the funding agencies. 664
665
References 666
1 Callaway, E., Cyranoski, D., Mallapaty, S., Stoye, E. & Tollefson, J. The coronavirus 667
pandemic in five powerful charts. Nature 579, 482 -483, doi:10.1038/d41586 -020-00758- 668
2 (2020). 669
2 Bucsan, A. N., Mehra, S., Khader, S. A. & Kaushal, D. The current state of animal models 670
and genomic approaches towards identifying and validating molecular determinants of 671
Mycobacterium tuberculosis infection and tuberculosis disease. Pathog Dis 77, 672
doi:10.1093/femspd/ftz037 (2019). 673
3 Gretebeck, L. M. & Subbarao, K. Animal models for SARS and MERS coronaviruses. Curr 674
Opin Virol 13, 123 -129, doi:10.1016/j.coviro.2015.06.009 (2015). 675
4 Rockx, B. et al. Comparative pathogenesis of COVID-19, MERS, and SARS in a nonhuman 676
primate model. Science, doi:10.1126/science.abb7314 (2020). 677
5 Munster, V. J. et al. Respiratory disease in rhesus macaques inoculated with SARS-CoV-2. 678
Nature , doi:10.1038/s41586 -020-2324-7 (2020). 679
6 Yu, J. et al. DNA vaccine protection against SARS-CoV-2 in rhesus macaques. Science, 680
doi:10.1126/science.abc6284 (2020). 681
7 Chandrashekar, A. et al. SARS-CoV-2 infection protects against rechallenge in rhesus 682
macaques. Science, doi:10.1126/science.abc4776 (2020). 683
8 Cockrell, A. S. et al. A spike-modified Middle East respiratory syndrome coronavirus 684
(MERS-CoV) infectious clone elicits mild respiratory disease in infected rhesus macaques. 685
Sci Rep 8, 10727, doi:10.1038/s41598 -018-28900-1 (2018). 686
9 Mantlo, E., Bukreyeva, N., Maruyama, J., Paessler, S. & Huang, C. Antiviral activities of 687
type I interferons to SARS-CoV-2 infection. Antiviral Res 179, 104811, 688
doi:10.1016/j.antiviral.2020.104811 (2020). 689 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148858
10 Nile, S. H. et al. COVID-19: Pathogenesis, cytokine storm and therapeutic potential of 690
interferons. Cytokine Growth Factor Rev , doi:10.1016/j.cytogfr.2020.05.002 (2020). 691
11 Bucsan, A. N. et al. Mechanisms of reactivation of latent tuberculosis infection due to SIV 692
co-infection. J Clin Invest, doi:10.1172/JCI125810 (2019). 693
12 Gautam, U. S. et al. In vivo inhibition of tryptophan catabolism reorganizes the 694
tuberculoma and augments immune-mediated control of Mycobacterium tuberculosis. 695
Proc Natl Acad Sci U S A 115, E62-E71, doi:10.1073/pnas.1711373114 (2018). 696
13 Cai, Y. et al. In vivo characterization of alveolar and interstitial lung macrophages in rhesus 697
macaques: implications for understanding lung disease in humans. J Immunol 192, 2821 - 698
2829, doi:10.4049/jimmunol.1302269 (2014). 699
14 Kuroda, M. J. et al. High Turnover of Tissue Macrophages Contributes to Tuberculosis 700
Reactivation in Simian Immunodeficiency Virus-Infected Rhesus Macaques. J Infect Dis, 701
doi:10.1093/infdis/jix625 (2018). 702
15 Barber, D. L. et al. Restoring function in exhausted CD8 T cells during chronic viral 703
infection. Nature 439, 682 -687, doi:10.1038/nature04444 (2006). 704
16 Ahmed, M. et al. Immune correlates of tuberculosis disease and risk translate across 705
species. Sci Transl Med 12, doi:10.1126/scitranslmed.aay0233 (2020). 706
17 Darrah, P. A. et al. Prevention of tuberculosis in macaques after intravenous BCG 707
immunization. Nature 577, 95-102, doi:10.1038/s41586-019-1817-8 (2020). 708
18 Veazey, R. S. et al. Gastrointestinal tract as a major site of CD4+ T cell depletion and viral 709
replication in SIV infection. Science 280, 427 -431 (1998). 710
19 Barouch, D. H., Klasse, P. J., Dufour, J., Veazey, R. S. & Moore, J. P. Macaque studies of 711
vaccine and microbicide combinations for preventing HIV-1 sexual transmission. Proc Natl 712
Acad Sci U S A 109, 8694 -8698, doi:10.1073/pnas.1203183109 (2012). 713
20 Cox, L. A. et al. Nonhuman Primates and Translational Research-Cardiovascular Disease. 714
ILAR J 58, 235 -250, doi:10.1093/ilar/ilx025 (2017). 715
21 Rincon-Choles, H. et al. Renal histopathology of a baboon model with type 2 diabetes. 716
Toxicol Pathol 40, 1020 -1030, doi:10.1177/0192623312444025 (2012). 717
22 Cole, S. A., Laviada-Molina, H. A., Serres-Perales, J. M., Rodriguez-Ayala, E. & 718
Bastarrachea, R. A. The COVID-19 Pandemic during the Time of the Diabetes Pandemic: 719
Likely Fraternal Twins? Pathogens 9, doi:10.3390/pathogens9050389 (2020). 720
23 Kaushal, D. et al. Mucosal vaccination with attenuated Mycobacterium tuberculosis 721
induces strong central memory responses and protects against tuberculosis. Nat Commun 722
6, 8533, doi:10.1038/ncomms9533 (2015). 723
24 Bucsan, A. N. et al. Mechanisms of reactivation of latent tuberculosis infection due to SIV 724
coinfection. J Clin Invest 129, 5254 -5260, doi:10.1172/JCI125810 (2019). 725
25 Foreman, T. W. et al. Isoniazid and Rifapentine Treatment Eradicates Persistent 726
Mycobacterium tuberculosis in Macaques. Am J Respir Crit Care Med, 727
doi:10.1164/rccm.201903 -0646OC (2019). 728
26 Foreman, T. W. et al. CD4+ T-cell-independent mechanisms suppress reactivation of 729
latent tuberculosis in a macaque model of HIV coinfection. Proc Natl Acad Sci U S A 113, 730
E5636 -5644, doi:10.1073/pnas.1611987113 (2016). 731 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148859
27 Mehra, S. et al. Granuloma correlates of protection against tuberculosis and mechanisms 732
of immune modulation by Mycobacterium tuberculosis. J Infect Dis 207, 1115 -1127, 733
doi:10.1093/infdis/jis778 (2013). 734
28 Joosten, S. A. et al. Mycobacterium tuberculosis peptides presented by HLA-E molecules 735
are targets for human CD8 T-cells with cytotoxic as well as regulatory activity. PLoS Pathog 736
6, e1000782, doi:10.1371/journal.ppat.1000782 (2010). 737
29 Raju, R. M. et al. Post-translational regulation via Clp protease is critical for survival of 738
Mycobacterium tuberculosis. PLoS Pathog 10, e1003994, 739
doi:10.1371/journal.ppat.1003994 (2014). 740
30 Winglee, K. et al. Aerosol Mycobacterium tuberculosis infection causes rapid loss of 741
diversity in gut microbiota. PLoS One 9, e97048, doi:10.1371/journal.pone.0097048 742
(2014). 743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148860
Figure legends 760
761
Figure 1. Clinical correlates of SARS-CoV-2 infection in rhesus macaques over 0 -3 dpi. Changes 762
in serum CRP (mg/L) (a), albumin (ALB) (g/dL) (b), hemoglobin (HGB) content (g/dL) (c), 763
longitudinally in peripheral blood. Viral RNA (log 10 copies/mL were measured by RT-PCR in BAL 764
fluid (d), nasopharyngeal (e), and buccopharyngeal (f) swabs longitudinally (red – 0 dpi; purple – 765
1 dpi; blue – 2 dpi; green – 3 dpi) . Viral RNA was also measured in lung tissue homogenates at 766
endpoint (3 dpi) and data is expressed as log 10 copies/gram of the lung tissue for random samples 767
from three lobes in left (orange) and right (teal) lungs (g Hematoxylin and eosin (H&E) staining 768
was performed on formalin-fixed paraffin-embedded (FFPE) lung sections from infected animals 769
for pathological analysis Histopathologic analysis revealed bronchitis characterized by infiltrates 770
of macrophages, lymphocytes, neutrophils, and eosinophils that expanded the wall (bracket), 771
and along with syncytial cells (arrows) filled the bronchiole lumen and adjacent alveolar spaces. 772
(h); Suppurative interstitial pneumonia with Type II pneumocyte hyperplasia (arrowheads) and 773
alveolar space filled with neutrophils, macrophages and fibrin (*). Bracket denotes alveolar 774
space. (i). Multilabel confocal immunofluorescence microscopy of lungs (j) and nasal epithelium 775
(k) at 63x with Nucleocapsid (N) specific antibody (green) DAPI (blue), and ACE2 (red). (a-f) Data 776
is represented as mean+ SEM (n=4). ). (c-g) Undetectable results are represented as 1 copy. One 777
way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s 778
post hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, 779
*** P<0.0005. 780
781 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148861
782
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148862
Figure 2. Radiologic evaluation of the lung compartment following SARS-CoV-2 infection in 783
rhesus macaques over 0-3 dpi including by hyperdensity analyses. CXR (a) and CT (e) scores 784
generated by a veterinary radiologist blinded to the experimental group (red – 0 dpi; purple – 1 785
dpi; blue – 2 dpi; green – 3 dpi) . (a) Data is represented as mean+ SEM (n=4). One way Repeated- 786
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 787
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.05. Representative CT scan 788
images performed on Day 0-2 dpi show (b) transverse, (c) vertical, (d) longitudinal view of left 789
caudal lobe ground glass opacity on 1 dpi (middle), 2 dpi 28 and baseline at 0 dpi (upper inset). CT 790
scans (b-d) revealed evidence of pneumonia and lung abnormalities in the infected animals 791
relative to controls which resolved between 1 to 2 dpi (red arrow). 3D reconstruction (f) of ROI 792
volume representing the location of lesion. (Fig 2g-i) represent image for quantification of lung 793
lesion with green area representing normal intensity lung voxels (-850 HU to -500 HU), while red 794
areas represent hyperdense voxels (-490 HU to 500 HU). Percent change in lung hyperdensity in 795
SARS-CoV2 infected animals over Day 1-3 dpi compared to the baseline(j). (re d – 0 dpi; purple – 796
1 dpi; blue – 2 dpi; green – 3 dpi). (e, j) Data represented as (mean + SEM) (n=4 for 0-2 dpi, n=2 797
for 3dpi). Ordinary one-way ANOVA with Dunnett’s post hoc test was applied. 798
799
800
801
802
803
804 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148863
805
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148864
Figure 3. SARS-CoV-2 induced alveolar inflammation. Simultaneous analysis of multiple 806
cytokines by Luminex technology in the BAL fluid of rhesus macaques over 0-3 dpi. Levels of IL-6 807
(a), IFN-a (b), IFN-g (c), IL-8 (d), perforin (e), IP-10 (f), MIP1a (g), MIP1b (h), IL-12p40 (i), IL-18 (j), 808
TNF (k) and IL-1Ra (l) are expressed in Log10 concentration in picogram per mL of BAL fluid. (red 809
– 0 dpi; purple – 1 dpi; blue – 2 dpi; green – 3 dpi). Data is represented as mean+ SEM (n=4). One 810
way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s 811
post hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, 812
*** P<0.0005. 813
814
815
816
817
818
819
820
821
822
823
824
825
826
827 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148865
828
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148866
Figure 4. Longitudinal clinical and histopathological correlates of SARS-CoV-2 infection in 829
rhesus macaques, baboons and marmosets over two weeks. Viral RNA (log 10 copies/mL were 830
measured by RT-PCR in BAL fluid (a) and nasopharyngeal (b) swabs of SARS-CoV-2 infected rhesus 831
macaques longitudinally (red – 0 dpi; purple – 3 dpi; black – 6 dpi: blue – 9 dpi; orange – 12 dpi: 832
green – 14-17 dpi). (n=12) One way Repeated-measures ANOVA with Geisser-Greenhouse 833
correction for sphericity and Tukey’s post hoc correction for multiple-testing (GraphPad Prism 8) 834
was applied. * P<0.005, *** P<0.0005. Viral RNA was also measured in lung tissue homogenates 835
of infected rhesus macaques at endpoint (14-17 dpi) and data is expressed as log 10 copies/gram 836
of the lung tissue for random samples from three lobes in left (orange) and right (teal) lungs (c). 837
Histopathologic analysis revealed regionally extensive interstitial lymphocytes, plasma cells, 838
lesser macrophages and eosinophils expanding the alveolar septa (bracket) and alveolar spaces 839
filled with macrophages (*). Normal alveolar wall is highlighted (arrow) for comparison (d). 840
Alveolar spaces with extensive interstitial alveolar wall thickening by deposits of collagen (*) and 841
scattered alveolar macrophages (arrow) (e). Viral RNA (log 10 copies/mL were measured by RT- 842
PCR in BAL fluid (f) and Nasopharyngeal (g) swab from SARS-CoV-2 infected baboons. (n=6) One 843
way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s 844
post hoc correction for multiple-testing (GraphPad Prism 8) was applied. Histopathologic analysis 845
revealed regionally extensive interstitial lymphocytes, plasma cells, lesser macrophages and 846
eosinophils expanding the alveolar septa (bracket) and alveolar spaces filled with macrophages 847
(*), (h). Alveolar wall thickening by interstitial deposits of collagen (*), alveoli lined by occasional 848
type II pneumocytes (arrowhead) and alveolar spaces containing syncytial cells (arrow) and 849
alveolar macrophages (i). Viral RNA (log 10 copies/mL were measured by RT-PCR in marmoset 850 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148867
nasal wash (j) and oral (k) swabs longitudinally (red – 0 dpi; purple – 3 dpi; blue – 6 dpi; green – 851
9 dpi; black – 14-17 dpi). n=6 for 0-3 dpi and n=4 for 6-14 dpi) . .Histopathologic analysis revealed 852
milder form of interstitial lymphocytes, and macrophages recruited to the alveolar space (m, n). 853
Ordinary one-way ANOVA with Dunnett’s post hoc test was applied. Viral RNA was also measured 854
in lung homogenates at endpoint (3 dpi & 14 dpi) and data is expressed as log 10 copies/gram of 855
the lung for random samples from left and right lobes at 3 dpi (orange) and 14 dpi (teal) (g). Data 856
is represented as mean+ SEM. ** P<0.005, **** P<0.00005. 857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148868
873 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148869
874
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148870
Figure 5. CXR (a) scores generated by a veterinary radiologist blinded to the experimental group 875
(n=12) and (b) CXR scores split in old and young macaques (n=6). CXR radiographs showing 876
minimal right caudal interstitial pattern at 0 dpi (c), Alveolar pattern associated with the caudal 877
sub segmen t of the left cranial lung lobe and left caudal lung lobe with patchy right caudal 878
interstitial opacity at 6 dpi (d) and Minimal left caudal interstitial pattern at 14dpi (e). CT (f) scores 879
generated by a blinded veterinary radiologist (n=6). 3D reconstruction (g,k) of ROI volume 880
representing the location of lesion. (h-j, l -n) represent image for quantification of lung lesion with 881
green area representing normal intensity lung voxels (-850 HU to -500 HU), while red areas 882
represent hyperdense voxels (-490 HU to 500 HU). Percent change in lung hyperdensity in SARS- 883
CoV2 infected animals over 6 dpi compared to 12 dpi (o) (n=6). Data is represented as mean+ 884
SEM. (a) One way & (b) two way Repeated-measures ANOVA with Geisser-Greenhouse correction 885
for sphericity and Tukey’s post hoc correction for multiple-testing and (f,o) Paired T test 886
(GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** P<0.0005. 887
888
889
890
891
892
893
894
895
896 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148871
897
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148872
Figure 6. Longitudinal accumulation of myeloid cells in BAL following SARS-CoV-2 infection in 898
rhesus macaques. Flow cytometric analysis of BAL IMs (a, e), AMs (b, f), neutrophils (c,g), and 899
pDCs (d, h). Data shown combined for age (a-d) (n=12); data split by age (g-h) (n=6). Data is 900
represented as mean+ SEM. (a-d) One way and (e-h) two way Repeated-measures ANOVA with 901
Geisser -Greenhouse correction for sphericity and Tukey’s post hoc correction for multiple-testing 902
(GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** P<0.0005. Coloring scheme for e -h 903
– young (blue), old (red). Correlations with Spearman’s rank test between cellular fraction and 904
Log10 viral RNA copy number in BAL (i) and corresponding values for Spearman's rank correlation 905
coefficient (j) and P value (Suppl. Fig13i). Coloring scheme for i – Neutrophil (blue), IM (red), AM 906
(orange, pDC (green). Multilabel confocal immunofluorescence microscopy of FFPE lung sections 907
from SARS CoV-2 infected Rhesus macaques having a high viral titer at 3 dpi (k-p) with SARS CoV- 908
2 Spike specific antibody (green), KI-67 29, neutrophil marker CD66abce (red) and DAPI (blue) at 909
10X (k) and 63X (l); SARS CoV-2 Spike (green), pan-macrophage marker CD68 (red) and DAPI 910
(blue) at 10X (m) and 63X (n); SARS CoV-2 Spike (green), HLA-DR 29, pDC marker CD123 (red) and 911
DAPI (blue) at 10X (o) and 63X (p). 912
913
914
915
916
917
918
919 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148873
920
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148874
Figure 7. Longitudinal changes in T cells in BAL following SARS-CoV-2 infection in rhesus 921
macaques. BAL Frequencies of CD3+ T cells (a), CD4+ T cells (b), CD8+ T cells (g), CD4+ T cell subsets 922
expressing early activation marker CD69 (c), CXCR3 (d), PD-1 (e) and memory marker CCR7 (f), 923
CCR5 (l), HLA-DR (m) and LAG-3 (n); CD8+ T cell subsets expressing early activation marker CD69 924
(h), CXCR3 (i), PD-1 (j) and memory marker CCR7 (k), CCR5 (o), HLA-DR (p) and LAG-3 (q). Coloring 925
scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=6) Two way Repeated- 926
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 927
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 928
P<0.0005. 929
930
931
932
933
934
935
936
937
938
939
940
941
942 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148875
943
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148876
Figure 8. Longitudinal changes in memory T cells in BAL following SARS-CoV-2 infection in 944
rhesus macaques . BAL Frequencies of CD4+ T cell subsets expressing KI67 (a), Memory (b), Naïve 945
(c), Effector (d), IL-2 (e) and Granzyme B (f). Frequencies of CD8+ T cell subsets expressing KI67 946
(g), Memory (h), Naïve (i), Effector (j), IL-2 (k) and Granzyme B (l). BAL cells were stimulated 947
overnight (12-14 hours) with either Mock control (U); PMA-Ionomycin (P/I) or SARS-CoV-2 - 948
specific peptide pools of the nucleocapsid (N), membrane (M) and spike (S) proteins. Antigen 949
specific cytokine secretion in T cells was estimated by flow cytometry. Fraction of CD4+ T cells 950
secreting IL-2 (m), Granzyme B (n); CD8+ T cells secreting IL-2 (o) and Granzyme B (p). Coloring 951
scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=6) two way Repeated- 952
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 953
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 954
P<0.0005. 955
956
957
958
959
960
961
962
963
964
965 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148877
966
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148878
Figure S1. Clinical correlates in short -term (0 -3 dpi) rhesus macaques. Serum levels of tCO2 (D- 967
mmol/L) (a), and whole blood levels of Red Blood Cells (RBCs) (million/mL) (b), reticulocytes 968
(K/mL) (c), White Blood Cells (WBCs) (K/mL) (d), platelets (K/uL) (e), Neutrophils (K/mL) (f), 969
percentage of Neutrophils (g), percentage of monocytes (h). Viral RNA (log 10 copies/mL were 970
measured by RT-PCR in saliva (i), and rectal swab (j). ) Data is represented as mean+ SEM (n=4). 971
One way Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and 972
Tukey’s post hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** 973
P<0.005, *** P<0.0005. 974
975
976
977
978
979
980
981
982
983
984
985
986
987
988 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148879
989
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148880
Figure S2. Gross and histopathologic findings of young and aged male and female Rhesus 990
macaques experimentally exposed to COVID19 - 3 dpi. Young male Rhesus macaque. Lung was 991
grossly unremarkable (a). Aged male Rhesus macaque. Lung. The dorsal aspect of the lungs was 992
mottled red (*) (b). Aged male Rhesus macaque. Lung. Sub gross image showing extensive areas 993
of consolidation (*) (c). Aged male Rhesus macaque. Lung. Moderate interstitial pneumonia with 994
scattered type II pneumocytes (arrow), neutrophils (arrowhead), and intra-alveolar fibrin 995
deposition (*) (d). Aged female Rhesus macaque. Lung. Mild interstitial pneumonia with 996
scattered syncytial cells (arrow), neutrophils (arrowhead), and expansion of alveolar walls by 997
fibrosis (bracket) (e). Young female Rhesus macaque. Lung. Vasculitis. Vascular wall disrupted by 998
infiltrates of mononuclear cells and lesser neutrophils. Vessel lumen marked by (*) (f). Young 999
female Rhesus macaque. Lung. Mild interstitial pneumonia. Alveolar spaces contain neutrophils 1000
and cellular debris (necrosis, arrow) (g). Young female Rhesus macaque. Lung. Mild interstitial 1001
pneumonia. Alveolar spaces (*) contain neutrophils and eosinophilic fluid (edema) (h). Young 1002
female Rhesus macaque. Lung. Bronchiolitis. Bronchiolar wall expanded by infiltrate s of 1003
lymphocytes and macrophages (bracket) (i). Young male Rhesus macaque. Lung. Bronchitis. 1004
Bronchial wall expanded by infiltrates of eosinophils that expand and disrupt the epithelium and 1005
smooth muscle (bracket) (j). Young female Rhesus macaque. Lung. Bronchitis. Bronchial lumen 1006
contains macrophages (arrowhead), cellular debris, and syncytial cells (arrow) (k). Aged female 1007
Rhesus macaque. Lung. Area of bronchiolar associated lymphoid tissue (BALT) (*) (l). All slides 1008
were stained with H&E. 1009
1010 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148881
1011
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148882
Fig S3. Multi-label confocal immunofluorescence microscopy of lungs (20X-a, 63X-g), nasal 1012
epithelium (20X-b, 63x -h) and tonsil (20X-c,63X-i) with SARS CoV-2 N specific antibody (green), 1013
DAPI (blue) and ACE-2 (red). Rabbit IgG isotype control antibody was used to rule out non-specific 1014
staining in lungs (20X-d, 63X -j), nasal epithelium (20X-e, 63x -k) and tonsil (20X-f, 63X -l). Staining 1015
in naïve rhesus macaque lung tissues did not show N signal in lungs (m) or nasal epithelium (n). 1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148883
1033
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148884
Figure S4. Multi-label confocal immunofluorescence microscopy of lungs (10X-a, 63X-g), nasal 1034
epithelium (10X-b, 63x-h) and tonsil (10X-c,63X-i) with SARS CoV-2 S specific antibody (green) 1035
and DAPI (blue). Rabbit IgG isotype control antibody was used to stain the tissues to rule out any 1036
non-specific staining. The panels showing isotype control staining include: lungs (10X-d, 63X -j), 1037
nasal epithelium (10X-e, 63X-k) and tonsil (10X-f, 63X -l). 1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148885
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148886
Figure S5. Radiology of Rhesus macaques experimentally exposed to COVID19 - 3 dpi. CXR 1060
Radiographs showing ventrodorsal and right lateral views(a). Day 0: Normal, Day 1: Mild left 1061
caudal interstitial opacity with minimal diffuse right interstitial opacity, Day 2: Mild multifocal 1062
interstitial pattern (red arrow), Day 3: Mild multifocal interstitial pattern with patchy region in 1063
left caudal lobe (red arrow). CT scan axial view showing lesion characteristics in rhesus macaques 1064
infected with SARS-CoV-2 (b) at baseline and Day 1-3 dpi. As seen in (b) ground glass opacity seen 1065
on Day 2 dpi intensified on Day 3 dpi. (c) and (d) show lesions that appear on Day 1 show gradual 1066
resolution on Day 2-3 dpi whereas lesion in panel (e) observed on Day 1 dpi showed only minimal 1067
changes on Day 2. Red arrow point towards lung lesions with high attenuation. 1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148887
1082
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148888
Figure S6. SARS-CoV-2 induced cytokines in plasma. Simultaneous analysis of multiple cytokines 1083
by Luminex technology in the plasma of rhesus macaques over 0-3 dpi. Levels of IL-6 (a), IFN-a 1084
(b), IFN-g (c), IL-8 (d), perforin (e), IP-10 (f), MIP1a (g), MIP1b (h), IL-12p40 (i), IL-18 (j), TNF-a (k) 1085
and IL-1Ra (l)are expressed in Log10 concentration in picogram per mL of plasma. (red – 0 dpi; 1086
purple – 1 dpi; blue – 2 dpi; gre en – 3 dpi). (n=4) Data is represented as mean+ SEM. One way 1087
repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post 1088
hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1089
P<0.0005. 1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148889
1105
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148890
Figure S7. Clinical correlates in long-term (14-17 dpi) rhesus macaques. Serum levels of CRP 1106
(mg/L) (a), tCO2 (D-mmol/L) (b), and whole blood levels of Red Blood Cells (RBCs) (million/mL) 1107
(c), reticulocytes (K/mL) (d), percentage of Neutrophils (g), Neutrophils (K/mL) (f), platelets (K/uL) 1108
(e), percentage of monocytes (h) and percent change in weight (i) (Coloring scheme for I – young 1109
(blue), old (red).). (a -e) (n=12) Data is represented as mean+ SEM. One way repeated-measures 1110
ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc correction for 1111
multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** P<0.0005. 1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148891
1128
1129
1130
1131
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148892
Figure S8. Longitudinal viral RNA determination following SARS-CoV-2 infection in rhesus 1132
macaques. Viral RNA (log 10 copies/mL measured by RT-PCR in BAL fluid (a) and nasopharyngeal 1133
(b), buccopharyngeal (c-d) and rectal 30 swabs longitudinally. Data is depicted as combined for 1134
age (c,e) and data split by age a; b; d; f). Coloring scheme for c; e – (red – 0 dpi; purple – 3 dpi; 1135
blue – 6 dpi: green – 9 dpi; orange – 12 dpi: black – 14-17 dpi). (n=12) One way Repeated- 1136
measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post hoc 1137
correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1138
P<0.0005. Coloring scheme for a; b; d; f – young (blue), old (red). (n=6) Data is represented as 1139
mean+ SEM. Two way Repeated-measures ANOVA with Geisser-Greenhouse correction for 1140
sphericity and Tukey’ s post hoc correction for multiple-testing (GraphPad Prism 8) was applied. 1141
** P<0.005. 1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148893
1154
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148894
Figure S9. Longitudinal viral RNA determination following SARS-CoV-2 infection in rhesus 1155
macaques. Viral RNA was determined at endpoint in Lungs (a) and longitudinally in plasma (b) 1156
and urine (c). 1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148895
1177
1178
1179
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148896
Figure S10. Gross and histopathologic findings of young and aged male and female Rhesus 1180
macaques experimentally exposed to SARS-CoV-2 - 14-17 dpi. Young male Rhesus macaque. 1181
Lung was grossly unremarkable (a). Aged male Rhesus macaque. The dorsal aspect of the lungs 1182
was mottled red (b). Young male Rhesus macaque. Lung. Subgross image showing multifocal 1183
areas of minimal interstitial pneumonia (*) (c). Young female Rhesus macaque. Lung. Mild 1184
lymphocytic interstitial pneumonia with alveolar septa (bracket) expanded by mononuclear cells 1185
(lymphocytes and macrophages) (d). Aged female Rhesus macaque. Lung. Mild lymphocytic 1186
interstitial pneumonia with increased alveolar macrophages and few syncytial cells (arrow) 1187
within the alveolar lumen (*; a neutrophil is just to the left of the *) and type II pneumocytes 1188
lining alveoli (arrowhead) (e). Aged female Rhesus macaque. Lung. Minimal interstitial 1189
pneumonia with alveolar septa expanded by fibrosis (*) and few syncytial cells (arrow) within 1190
alveoli (f). Young male Rhesus macaque. Lung. Alveolar septa expanded by fibrosis (*) and 1191
lymphocyte infiltrates (g). Aged male Rhesus macaque. Lung. Areas of bronchiolization (arrows) 1192
(h). Young female Rhesus macaque. Lung. Vasculitis. Vascular wall disrupted by infiltrates of 1193
mononuclear cells and lesser neutrophils (arrow) (i). Young female Rhesus macaque. Lung. 1194
Bronchitis. Bronchial epithelium infiltrated by eosinophils (arrow). Fibrosis adjacent to bronchus 1195
(*) (j). Young female Rhesus macaque. Lung. Area of perivascular lymphocyte infiltrates (*) (k). 1196
Young female Rhesus macaque. Lung. Area of bronchiolar associated lymphoid tissue (BALT) (*) 1197
(l). All slides were stained with H&E. 1198
1199
1200
1201 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148897
1202
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148898
Figure S11. Viral, Gross and histopathologic findings of young male and female baboons 1203
experimentally exposed to COVID19 - 14-17 dpi. Viral RNA (log 10 copies/mL were measured by 1204
RT-PCR in buccopharyngeal (a) and rectal (b) swabs longitudinally. Young male baboon. Th e 1205
dorsal aspect of the lungs was mottled red (*) (c). Young female baboon. The dorsal aspect of the 1206
lungs was mottled red (*) (d). Young male baboon. Lung. Subgross image showing areas of 1207
consolidation (*) (e). Young female baboon. Moderate lymphocytic interstitial pneumonia with 1208
scattered neutrophils (arrowhead) (f). Young female baboon. Moderate lymphocytic interstitial 1209
pneumonia with alveolar septa (bracket) markedly expanded by mononuclear cells (lymphocytes 1210
and macrophages) and increased alveolar macrophages within the alveolar lumen (*) (g). Young 1211
male baboon. Lung. Mild lymphocytic interstitial pneumonia with increased alveolar 1212
macrophages and few syncytial cells (arrow) within the alveolar lumen (*) (h). Young female 1213
baboon. Mild lymphocytic interstitial pneumonia with scattered type II pneumocytes (arrows) 1214
and increased alveolar macrophages and neutrophils within the alveolar lumen (*) (i). Young 1215
male baboon. Lung. Alveolar septa expanded by fibrosis (*) (j). Young male baboon. Lung. 1216
Alveolar septa expanded by fibrosis (*) (k). Young female baboon. Area of bronchiolization 1217
(bracket) (l). Young male baboon. Lung. Syncytial cells within airways (arrows) (m). Young male 1218
baboon. Lung. Bronchitis. Bronchial wall expanded by infiltrates of eosinophils that expand and 1219
disrupt the epithelium (arrow). Area of bronchiolar associated lymphoid tissue (BALT) (*) (n). All 1220
slides were stained with H&E. 1221
1222
1223
1224 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148899
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148900
Figure S12. CT scan in axial view showing lesion characteristics in rhesus macaques infected with 1247
SARS-CoV-2 from Day 6-12 dpi. As seen in panel A, B, D, E and F patchy alveolar patterns, nodular 1248
and/or multifocal ground glass opacities (red arrow) seen on Day 6 dpi show dramatic resolution 1249
by Day 12 dpi, whereas panel C shows persistent patchy ground glass opacity on Day 6 dpi and 1250
Day 12 dpi. 1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148901
1269
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148902
Figure S13. Accumulation of various types of myeloid cells in BAL (a-d) and PBMCs (c-h). Total 1270
myeloid cell compartment in the BAL in all animals (a) (n=12), and in two groups of macaques 1271
split by age (b). percentage of cDCs (c) and intermediate monocytes (d) in BAL. Percentage of 1272
interstitial (e) and alveolar (f) macrophages, pDCs (g) and intermediate macrophages (h) in the 1273
peripheral blood. Coloring scheme for b -h – young (blue), old (red) (n=6). (i) P value table for 1274
Spearman’s correlation curve in Fig 5i. 1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148903
1292
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148904
Figure S14. Detection of SARS-CoV-2 signal in host lung cells by confocal microscopy. Multi-label 1293
confocal immunofluorescence microscopy of a high viral titer lung lobe from SARS CoV-2 infected 1294
Rhesus macaque at 3 dpi with SARS CoV-2 Spike specific antibody (green), neutrophil marker 1295
CD66abce (red) and DAPI (blue)- (10X -a, 63X-g) vs the naïve control lungs (10X-d, 63X -j). SARS 1296
CoV-2 Spike (green), pan-macrophage marker CD68 (red) and DAPI (blue) in infected lungs (10X- 1297
b and 63X-h) vs the naïve control lungs (10X-e, 63X -k). SARS CoV-2 Spike (green), HLA-DR 29, pDC 1298
marker CD123 (red) and DAPI (blue) specific staining in infected lungs (10X-c,63X-i) vs naïve 1299
control lungs(10X-f, 63X -l). 1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148905
1315
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148906
Figure S15. Longitudinal changes in cytokine secretion profile in BAL T cells following SARS-CoV- 1316
2 infection in rhesus macaques . BAL Frequencies of CD4+ T cell subsets expressing Interferon- 𝜸 1317
(a), IL-17 (b), TNF- 𝛂 (c), CD8+ T cells expressing Interferon- 𝜸 (d), IL-17 (e), TNF- 𝛂 (f) cultured 1318
overnight without any external antigenic stimulation. BAL cells were also stimulated overnight 1319
(12-14 hours) with either Mock control (U); PMA-Ionomycin (P/I) or SARS-CoV-2 -specific peptide 1320
pools of the nucleocapsid (N), membrane (M) and spike (S) proteins. Antigen specific cytokine 1321
secretion in T cells was estimated by flow cytometry. Fraction of CD4+ T cell subsets expressing 1322
Interferon-g (g), IL-17 (h), TNF-a (i), CD8+ T cells expressing Interferon-g (j), IL-17 (k), TNF-a (l). 1323
Coloring scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=6) Two way 1324
Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post 1325
hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1326
P<0.0005. 1327
1328
1329
1330
1331
1332
1333
1334
1335
1336 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148907
1337
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148908
Figure S16. Longitudinal changes in SARS-CoV-2 induced cytokines in BAL fluid and plasma 1338
following SARS-CoV-2 infection in rhesus macaques over two weeks. Simultaneous analysis of 1339
multiple cytokines by Luminex technology in the BAL fluid and plasma of rhesus macaque s over 1340
0-15 dpi. Levels of IFN-a (a), IL-1Ra (b), IFN-g (c), TNF-a (d), IL-6 (e), Perforin (f) are expressed in 1341
Log10 concentration in picogram per mL of BAL fluid. Levels of IFN-a (g), IL-1Ra (h), IFN-g (i), TNF - 1342
a (j), IL-6 (k), Perforin (l) are expressed in Log10 concentration in picogram per mL of BAL fluid. 1343
Coloring scheme – young (blue), old (red). Data is represented as mean+ SEM. (n=12) Two way 1344
Repeated-measures ANOVA with Geisser-Greenhouse correction for sphericity and Tukey’s post 1345
hoc correction for multiple-testing (GraphPad Prism 8) was applied. * P<0.005, ** P<0.005, *** 1346
P<0.0005. 1347
1348
1349
1350
1351
1352
1353
1354
1355
1356
1357
1358
1359 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148909
1360
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148910
Figure S17. SARS-CoV-2 infection induces ACE-2 expression . RNAseq was performed on total 1361
RNA isolated from the lungs of naïve (n=3) and SARS-CoV-2 infected (14-17dpi) rhesus macaques 1362
(n=8, 3 young and 5 old macaques) as described earlier 16. Results indicate that the expression of 1363
ACE2, which is lower in naïve animals (denoted by red color in the heat map) (a), was induced 1364
following SARS-CoV-2 infection (denoted by blue color in the heat map) (a). Relative expression 1365
level of ACE-2 was significantly higher than in naïve tissues (b). Higher expression of ACE-2 was 1366
observed in lung tissues obtained at necropsy from young relative to old macaques (c, d), such 1367
that the difference between naïve animals and young SARS-CoV-2 infected animals in ACE-2 1368
expression levels was statistically significant by itself. All p-values shown on expression swarm 1369
plots (b-d) are FDR-corrected significance values for differential expression calculated by DESEQ2 1370
16. 1371
1372
1373
1374
1375
1376
1377
1378
1379
1380
1381
1382 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148911
1383
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148912
Figure S18. Flow cytometry Gating Strategy. Gating strategy for T cell phenotyping is described. 1384
1385
1386
1387
1388
1389
1390
1391
1392
1393
1394
1395
1396
1397
1398
1399
1400
1401
1402
1403
1404
1405 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148913
1406
. CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148914
Supplemental tables 1407
1408
Table S1. In vivo experimental design. A. short-term rhesus macaque pilot. B-D. 14-day 1409
multispecies comparison in rhesus macaques, baboons, marmosets. 1410
1411
Table S2. Distribution of lesions by anatomic location and morphologic diagnosis of young and 1412
aged rhesus macaques experimentally exposed to SARS-CoV-2 - 3 dpi. 1413
1414
Table S3. Distribution of lesions by anatomic location and morphologic diagnosis of young and 1415
aged rhesus macaques experimentally exposed to SARS-CoV-2 – 14-17 dpi. 1416
1417
Table S4. Distribution of lesions in baboons experimentally exposed to SARS-CoV-2 – 14-17 dpi. 1418
1419
Table S5. CXR scores in rhesus macaques experimentally exposed to SARS-CoV-2 – 14-17 dpi. 1420
1421
Table S6. CT scores in rhesus macaques experimentally exposed to SARS-CoV-2 – 14-17 dpi. 1422
1423
Table S7. List of antibodies used for immunophenotyping studies. 1424
1425
1426
1427 . CC-BY-NC-ND 4.0 International license available under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (which this version posted June 5, 2020. ; https://doi.org/10.1101/2020.06.05.136481doi: bioRxiv preprint
090177e19584de47\Final\Final On: 13-Nov-2020 17:17 (GMT)
FDA-CBER-2021-5683-1148915