125742 S1 M4 4.3 munster jv 2020

Pfizer Documents (PHMPT/FDA)

Pfizer Bla Submission

Pfizer 16 Plus Documents

19

Document text

nature https://doi.org/10 .1038/s41586-020-2324-7 
Accelerated Article Preview 
Respiratory disease in rhesus macaques 
inoculated with SARS-CoV-2 
Received : 22 March 2020 
Accepted: 1 May 2020 
Accelerated Article Preview Published 
on line 12 May 2020 
Cite this article as: Munster, V. J. et al. 
Respiratory disease in rhesus macaques 
inoculated with SARS-CoV-2. Nature 
https://doi.org/10.1038/s41586-020-2324-7 
(2020). Vincent J. Munster, Friederike Feldmann, Brandi N. Williamson, Neeltje van Doremalen, 
Lizzette Perez-Perez, Jonathan Schulz, Kimberly Meade-White, Atsushi Okumura, 
Julie Callison, Beniah Brumbaugh, Victoria A. Avanzato, Rebecca Rosenke, Patrick W. Hanley, 
Greg Saturday, Dana Scott, Elizabeth R. Fischer & Emmie de Wit 
This is a PDF file of a peer-reviewed paper that has been accepted for publication. 
Although unedited, the content has been subjected to preliminary formatting. Nature 
is providing this early version of the typeset paper as a service to our authors and 
readers. The text and figures will undergo copyediting and a proof review before the 
paper is published in its final form. Please note that during the production process 
errors may be discovered which could affect the content, and all legal disclaimers 
apply. 
Nature I www.nature.com 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710040
Article 
Respiratory disease in rhesus macaques 
inoculated with SARS-CoV-2 
https://doi.org/10.1038/s41586-020-2324-7 
Received: 22 March 2020 Vincent J. Munster', Friederike Feldmann2, Brandi N. Williamson', Neeltje van Doremalen', 
Lizzette Perez-Perez', Jonathan Schulz', Kimberly Meade-White', Atsushi Okumura', 
Julie Callison', Beniah Brumbaugh3, Victoria A. Avanzato', Rebecca Rosenke2, 
Accepted: 1 May 2020 Patrick W. Hanley2, Greg Saturday2, Dana Scott', Elizabeth R. Fischer3 & Emmie de Wit'~ 
Published on line: 12 May 2020 
An outbreak of a novel coronavirus, named SARS·CoV·2, causing respiratory disease 
and a -2% case fatality rate started in Wuhan, China in December 20191•2• Following 
unprecedented global spread3, the World Health Organization declared COVID· 19 a 
pandemic on March 11, 2020. Although data on disease in humans are emerging at a 
steady pace, certain aspects of the pathogenesis ofSARS·CoV·2 can only be studied in 
detail in animal models, where repeated sampling and tissue collection is possible. 
Here, we show that SARS·CoV·2 causes respiratory disease in infected rhesus 
macaques, with disease lasting 8· 16 days. Pulmonary infiltrates, a hallmark of human 
disease, were visible in lung radiographs. High viral loads were detected in swabs from 
the nose and throat of all animals as well as in bronchoalveolar lavages; in one animal 
we observed prolonged rectal shedding. Taken together, the rhesus macaque 
recapitulates moderate disease observed in the majority of human cases. The 
establishment of the rhesus macaque as a model ofCOVID·19 will increase our 
understanding of the pathogenesis of this disease and will aid development and 
testing of medical countermeasures. 
SARS-CoV -2 infection in humans can be asymptomatic or result in mild 
to fatal Coronavirus Disease2019 (COVID-19)4-6• Patients with COVID-19 
pneumonia presented mainly with fever, fatigue, dyspnea and cough7-9• 
Rapidly progressing pneumonia, with bilateral opacities on x-ray or 
patchy shadows and ground glass opacities by CT scan were observed in 
COVID-19 patients2•6•10• Older patients with comorbiditiesare at highest 
risk for adverse outcome ofCOVID-195.7. SARS-CoV-2 has been detected 
in upper and lower respiratory tract samples from patients, as well as 
feces and blood, but not in urine5•11-13• 
Non-human primate models that recapitulate aspects of human 
disease are essential forour understanding of the pathogenic processes 
involved in severe respiratory disease and the development of medical 
countermeasures such as vaccines and antivirals. 
Clinical, respirator disease 
Eight adult rhesus macaques were inoculated with SARS-CoV-2 isolate 
nCoV-WAl-202014• On day 1 post inoculation (dpi), all animals showed 
changes in respiratory pattern and piloerection, as reflected in their 
clinical scores (Fig. la). Other observed signs of disease included 
reduced appetite, hunched posture, pale appearance and dehydration 
(Extended Data Table 1). Coughing was occasionally heard in the room 
where animals were housed but could not be pinpointed to individual 
animals. Disease signs persisted for more than a week, with all animals 
completely recovered between 9and17 dpi (Fig. la and Table Sl). Weight 
loss was observed in all animals (Fig. lb); body temperatures spiked on 1 dpi but returned to normal levels thereafter (Fig. le). Under anesthesia, 
the animals did not show increased respiration; however, all animals 
showed irregular respiration patterns (Fig. Id). Radiographs showed 
pulmonary infiltrates in all animals starting on 1 dpi with mild pulmo­
nary infiltration primarily in the lower lung lobes. By3 dpi, progression 
of mild pulmonary infiltration was noted into other lung lobes although 
still primarily in the caudal lung lobes (Fig. le). In one animal, pulmonary 
infiltrates were observed from 1-12 dpi (Extended Data Fig. I). 
Hematologic analysis of blood collected during clinical exams 
showed evidence of a stress leukogram15by1 dpi in the majority of 
animals (Extended Data Fig. 2). Lymphocytes and monocytes returned 
to baseline after 1 dpi. Neutrophils decreased in all animals by 3 dpi 
and continued to decline through 5 dpi; neutropenia was observed in 
2 of 4 animals. On 1 dpi, decreased hematocrit, red blood cell counts 
and hemoglobin were observed in all animals (Extended Data Fig. 2). In 
addition, reticulocyte percentages and counts decreased. At 5 dpi, two 
of four animals had a normocytic, normochromic non-regenerative 
anemia consistent with anemia of critical illness; animals did not 
return to their original baselines by 21 dpi. Blood chemistry analysis 
revealed no values outside normal range (Supplementary Information 
TableS2). 
Serum was analyzed for changes in cytokine and chemokine levels at 
different time points after inoculation . Statistically significant changes 
wereonlyobserved onldpi, with increases in I Ura, IL6, ILlO, IUS, MCP-1. 
MIP-lb, and on 3 dpi a small but statistically significant decrease in 
TGFa was observed (Extended Data Fig. 3 ). Although changes occurred 
'Laborator y of Virology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton , MT, USA. 'Rocky Mountain Veterinary Branch, National Institute of Allergy 
and Infectious Diseases, National Institutes of Health, Hamilton , MT, USA. 'Research Technologies Branch, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 
Hamilton , MT, USA. ""e-mail, [email protected] 
Nature I www.nature.com I 1 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710041
Article 
in the levels of some of these cytokines later after inoculation, these 
were not statistically significant (Extended Data Fig. 3). 
High viral loads in respiratory samples 
Virus shedding was highest from the nose (Fig. 2a); virus could be iso· 
lated from swabs collected on 1and3 dpi, but not thereafter. Viral loads 
were high in throat swabs immediately after inoculation but were less 
consistent than nose swabs thereafter; in one animal throat swabs were 
positive on 1 and IO dpi but not in between (Fig. 2a). One animal showed 
prolonged shedding of viral RNA in rectal swabs; infectious virus could 
not be isolated from these swabs (Fig. 2a) and intestinal tract disease 
(e.g. diarrhea) was not observed . Urogenital swabs remained negative 
in all animals throughout the study. On 1, 3 and 5 dpi bronchoalveolar 
lavages (BAL) were performed on the 4animals in the group euthanized 
on 21 dpi. High viral loads were detected in BAL fluid in all animals on 
all three time points; infectious virus could only be isolated in BAL 
fluid collected on 1and3 dpi (Fig. 2b). No viral RNA could be detected 
in blood (Fig. 2c) or urine (Fig. 2d). 
Interstitial pneumonia 
On 3 and 2ldpi, one group of 4 animals was euthanized and necropsies 
were performed. 
On 3 dpi, varying degrees of gross lung lesions were observed in all 
animals (Fig. 3a and c). By 21 dpi, gross lesions were still visible in the 
lungs of2 of 4 animals (Fig. 3b and c). Additionally, all animals had an 
increased lungweight:bodyweight ratio (Fig. 3d) as compared to healthy 
rhesus macaques, indicative of pulmonary edema. Histologically, 3 of 
the4animals euthanized on 3 dpi developed some degree of pulmonary 
pathology . Lesions were multifocal (Extended Data Fig. 4a), mild to 
moderate, interstitial pneumonia that frequently centered on terminal 
bronchioles . The pneumonia was characterized by thickening of alveolar 
septae by edema fluid and fibrin and small to moderate numbers of 
macrophages and fewer neutrophils. Lungs with moderate changes also 
had alveolar edema and fibrin with formation ofhyaline membranes. 
There was minimal type II pneumocyte hyperplasia . Occasionally, bron· 
chioles showed necrosis, loss and attenuation of the epithelium with 
infiltrates of neutrophils, macrophages and eosinophils . Multifocally, 
there were perivascular infiltrates of small numbers of lymphocytes 
forming perivascular cuffs (Extended Data Figure 4b) and minimal to 
mild, multifocal hyperplasia ofbronchiolar associated lymphoid tissue. 
Three of 4 animals on 3 dpi had fibrous adhesions of the lung to the 
pleura. Histologic evaluation showed these to be composed of mature 
collagen interspersed with small blood vessels; therefore, this is most 
likely a chronic change rather than related to SARS-CoV-2 infection. 
Minimal to mild inflammation was observed in the upper airways with 
multifocal squamous metaplasia of the respiratory epithelium with 
infiltration of small numbers of neutrophils (Extended Data Figure 5). 
lmmunohistochemistry using a mAb against SARS-CoV demon­
strated viral antigen in small numbers of type I and II pneumocytes, 
as well as alveolar macrophages. Antigen-positive macrophages were 
detected in mediastinal lymph nodes of3 of 4 animals (Fig. 3k). lnter­
estingly, small numbers of antigen-positive lymphocytes and mac­
rophages were also detected in the lamina propria of the intestinal 
tract of all 4 animals. In one animal, all collected tissues of the gas­
trointestinal tract showed these antigen-positive mononuclear cells 
(Extended Data Figure 6). 
Ultrastructural analysis of lung tissue by transmission electron 
microscopy confirmed the histologic diagnosis of interstitial pneu­
monia. The alveolar interstitial space was greatly expanded by edema, 
fibrin, macrophages and neutrophils (Extended Data Figure ?a). The 
subepithelial basement membrane was unaffected and maintained 
a consistent thickness and electron density. Occasionally, type 
I pneumocytes are separated from the basement membrane by edema; 
2 I Nature I www.nature.com the resulting space may contain virions. Affected type I pneumocytes 
are lined by small to moderate numbers ofvirions 90-160 nm in diam­
eter with an electron dense core bound by a less dense caps id (Extended 
Data Figure 7b-e). Alveolar spaces adjacent to affected pneumocytes 
are filled with a granular, moderately electron dense material that is 
consistent with edema fluid. 
Replication in the respiratory tract 
All tissues (n=37) collected at necropsy were analyzed for the presence 
of viral RNA. On 3 dpi, high viral loads were detected in the lungs of all 
animals (Extended Data Fig. Sa); virus could be isolated from the lungs 
of all 4 animals at this time. Additionally, viral RNA could be detected in 
other samples throughout the respiratory tract (Extended Data Fig. 8), 
as well as in lymphoid and gastrointestinal tissues. Viral RNA could not 
be detected in major organs including the central nervous system. To 
distinguish viral RNA derived from respiratory secretions from active 
virus replication, all samples with presence of viral RNA were also tested 
for the presence of viral mRNA (Extended E>ata Fig. 8). Viral mRNA was 
detected in all respiratory tissues but could not in any but one of the 
gastrointestinal tissues, indicating that virus replication in these tissues 
seems unlikely, although we can't exclude it due to limited sample size. 
By 21 dpi, viral RNA, but not mRNA, could still be detected in tissues 
from all 4 animals (Extended Data Fig. Sg). 
Serology 
Serum was analyzed forthe development oflgG against SARS-CoV spike 
in ELISA. By IO dpi, all four animals had seroconverted to SARS-CoV-2 
spike;neutralizing responses also started to appear at IO dpi (Extended 
Data Figure 9). Interestingly, the animal with the lowest and latest 
neutralizing antibody response was the animal with prolonged viral 
shedding from the intestinal tract. 
Discussion 
COVID-19 clinical manifestations range from asymptomatic to mild to 
severe5•6·8·9·13·16. Patients present with influenza-like symptoms such as 
fever and shortness of breath and may develop pneumonia requiring 
mechanical ventilation and support in an intensive care unit9. Similar 
to SARS-CoV and MERS-CoV, comorbidities such as hypertension and 
diabetes play an important role in adverse outcome ofCOVID -198.17·18• 
Advanced age and chronic conditions in particular are indicators of a 
negative outcomes.7 -9·16, conditions that were absent in our healthy rhe­
sus macaques . An analysis ofI099 COVID-19 cases from China showed 
that approximately 5% of diagnosed patients developed severe pneu· 
monia requiring ICU attendance, 2-3% required mechanical ventila­
tion and 1.4% died9. The transient, moderate disease observed here in 
rhesus macaques is thus in line with the majority of human COVID-19 
cases. Pulmonary infiltrates on radiographs, a hallmark of human infec­
tion2.4·6·7·9·10.16, were observed in all macaques. The shedding pattern 
observed in rhesus macaques is strikingly similar to that observed 
in humans11·u. In humans, consistent high SARS-CoV-2 shedding was 
observed from the upper and lower respiratory tract, frequent inter­
mediate shedding from the intestinal tract and sporadic detection in 
blood5• Similar to humans, shedding ofSARS-CoV-2 continued after 
resolution of clinical symptoms and radiologic abnormalities19. Limited 
histopathology is available from COVID-19 patients20·21. Our analy­
sis of the histopathological changes observed in the lungs of rhesus 
macaques, suggests that they resemble those observed with SARS-CoV 
and MERS-CoV21-24, with regard to lesion type and cell tropism. 
Serological responses in humans are not typically detectable 
before 6 days after symptom onset, with lgG titers between IOO and 
I0,000 observed after 12 to 21 days25·26. Neutralizing titers were gen· 
erally between 20 -160. This corresponds to the results in our rhesus 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710042
macaque model, where lgG responses were detected around 7-10 dpi. 
Seroconversion was not directly followed by a decline in viral loads, as 
observed in COVID-19 patients25•26• 
Taken together, the rhesus macaque model recapitulates COVID-19, 
with regard to virus replication and shedding, the presence of pulmo­
nary infiltrates, histological lesions and seroconversion . This extensive 
dataset allows us to bridge between the rhesus macaques model and 
the disease observed in humans and to utilize this animal model to 
assess the efficacy of medical countermeasures. 
Online content 
Any methods, additional references, Nature Research reporting sum­
maries, source data, extended data, supplementary information, 
acknowledgements, peer review information; details of author con­
tributions and competing interests; and statements of data and code 
availability are available at https://doLorg/10.1038/s41586-020-2324-7. 
1. Wu, F. et al. A new coronavirus associated with human respirator y disease in China. 
Nature, httpsJ/doi.org/10.1038/s41586-020-2008-3 (2020). 
2. Zhu, N. et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J 
Med 382, 727-733, https,ffdoi.org/10.1056/NEJMoa2001017 (2020). 
3. Organization, W. H. Coronavirus disease (COVID-2019) situation reports, httpsJ/www.who. 
int/emergencies/diseases/novel-coronavirus-2019/situation-reports/ (2020). 
4. Yang, W. et al. Clinical characteristics and imaging manifestations of the 2019 novel 
coronavirus disease (COVI0-19),A multi-center study in Wenzhou city, Zhejiang, China. 
J Infect, httpsJ/doi.org/10.1016/j.jinf.2020.02.016 (2020). 
5. Yang, X. et al. Clinical course and outcomes of critically ill patients with SARS-CoV-2 
pneumonia in Wuhan, China: a single-centered, retrospective , observational study. 
Lancet Respir Med, httpsJ/doi.org/10.1016 /S2213-2600(20)30079-5 (2020). 
6. Silverstein, W. K., Stroud, L., Cleghorn, G. E. & Leis, J. A. First imported case of 2019 novel 
coronavirus in Canada, presenting as mild pneumonia. Lancet 395, 734, httpsJ/doi.org/ 
10.1016/S0140-6736(20)30370-6 (2020). 
7. Arentz, M. et al. Characteristics and Outcomes of 21 Critically Ill Patients With COVI0-19 in 
Washington State. JAMA, httpsJ/doi.org/10.1001/jama.2020.4326 (2020). 
8. Zhou, F. et al. Clinical course and risk factors for mortality of adult inpatients with 
COVID-19 in Wuhan, China, a retrospective cohort study. Lancet, https,//doi.org/10.1016/ 
S0140-6736(20)30566-3 (2020). 
9. Guan, W. J. et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N Engl J 
Med, https,//doi.org/10.1056/NEJMoa2002032 (2020). 
10. Shi, H. et al. Radiological findings from 81 patients with COVID-19 pneumonia in Wuhan, 
China, a descriptive study. Lancet Infect Dis, httpsJ/doi.org/10.1016/S1473-3099(20) 
30086-4 (2020). 
11. Zou, L. et al. SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients. 
N Engl J Med, https,ffdoi.org /10.1056/NEJMc2001737 (2020). 12. Kim, J. Y. et al. Viral Load Kinetics of SARS-CoV-2 Infection in First Two Patients in Korea. 
J Korean Med Sci 35, e86, httpsJ/doi.org/10.3346/jkms.2020.35.e86 (2020). 
13. Tang, A. et al. Detection of Novel Coronavirus by RT-PCR in Stool Specimen from 
Asymptomatic Child, China. Emerg Infect Dis 26, https,//doi.org/10.3201/eid2606.200301 
(2020). 
14. Harcourt , J. et al. Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with 
2019 Novel Coronavirus Disease, United States. Emerg Infect Dis 26, httpsJ/doi.org/ 
10.3201/eid2606.2005 16 (2020). 
15. Everds, N. E. et al. Interpreting stress responses during routine toxicity studies: a review of 
the biology, impact, and assessment. Toxicol Pathol 41, 560-614, https,ffdoi.org/ 
10.1177/0192623312466452 (2013). 
16. Wang, D. et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel 
Coronavirus-lnfected Pneumonia in Wuhan, China. JAMA, httpsJ/doi.org/10.1001/ 
jama.2020.1585 (2020). 
17. Assiri, A. et al. Epidemiological, demographic, and clinical characteristics of 47 cases of 
Middle East respiratory syndrome coronavirus disease from Saudi Arabia: a descriptive 
study. Lancet Infect Dis 13, 752-761, httpsJ/doi.org/10.1016/S1473-3099(13)70204-4 
(2013). 
18. Booth, C. M. et al. Clinical features and short-term outcomes of 144 patients with SARS in 
the greater Toronto area. JAMA 289, 2801-2809, https,ffdoi.org/10.1001/jama.289.21. 
JOC30885 (2003). 
19. Lan, L. et al. Positive RT-PCR Test Results in Patients Recovered From COVID-19. JAMA, 
httpsJ/doi.org/10.1001/jama.2020.2783 (2020). 
20. Tian, S. et al. Pulmonary Pathology of Early-Phase 2019 Nov.el Coronavirus (COVID-19) 
Pneumonia in Two Patients With Lung Cancer. J Thorac Oneal, httpsJ/doi.org/10.1016/j. 
jtho.2020.02.010 (2020). 
21. Xu, Z. et al. Pathological findings of COVID-19 associated with acute respiratory 
distress syndrome. Lancet Respir Med, https,ffdoi.org/10.1016/S2213-2600(20) 
30076-X (2020). 
22. Ng, D. L. et al. Clinicopathologic, lmmunohist ochemical, and Ultrastructural Findings of a 
Fatal Case of Middle East Respiratory Syndmme Coronavirus Infection in the United Arab 
Emirates, April 2014. Am J Pathol 186, 652-658, httpsJ/doi.org/10.1016/j.ajpath. 
2015.10.024 (2016). 
23. Nicholls, J.M. et al. Lung pathology of fatal severe acute respiratory syndrome. 
Lancet 361, 1773-1778, https,//doi.org/10.1016/s0140-6736(03)13413-7 (2003). 
24. Ding, Y. et al. The clinical pathology of severe acute respiratory syndrome (SARS), 
a report from China. J Pathol 200, 282-289, httpsJ/doi.org/10.1002/path.1440 
(2003). 
25. Roman Welfel' Victor M. Corman, W. G., Michael Seilmaier, Sabine Zange, Marcel A. 
Muller, Daniela Niemeyer , Terence C. Jones Kelly, Patrick Vollmar, Camilla Rothe, Michael 
Hoelscher , Tobias Bleicker, Sebastian Brunink, Julia Schneider, Rosina Ehmann, Katrin 
Zwirglmaier, Christian Drosten, Clemens Wendtner. Virological assessment of 
hospitalized cases of coronavirus disease 2019. MEDRXIV (2020). 
26. Zhao, Y., Wang, Liu, Liao, Su, Wang, Yuan, Li, Li, Qian, Hong, Wang, Liu, Wang, He, Li, He, 
Zhang, Ge, Liu, Zhang, Xia, Zhang. Antibody responses to SARS-CoV-2 in patients of novel 
coronavirus disease 2019. medRxiv (2020). 
Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in 
published maps and institutional affiliations. 
©This is a U.S. government work and not under copyright protection in the U.S.; foreign 
copyright protection may apply 2020 
Nature I www.nature.com I 3 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710043
Article 
a 30 b 105 
~ 20 
u 
"' Cii u 
:5 u 10 ., ~ ·= 100 Qi 
"' .. -" 
~ 95 ~ :E 
"' ·a; 
l: 90 .., 
'C 0 
[II 
85 
10 15 20 0 10 15 20 
Days post inoculation Days post inoculation 
c d e 
~ 80 4 
:I c: 
:§ 60 "' .s:: .. 
~ e 40 
c: 
0 :;::; 
E ·a. 20 ~ 
0 3 u 
"' .s:: a. E 2 "' 0 
=c .. 
Cl: 
"' ., 
Cl: 
0 
10 15 20 5 10 15 20 
Days post inoculation Days post inoculation Days post inoculation 
Fig. I I Rhesus macaques infected with SARS-CoV-2 develop respiratory 
disease. After inoculation with SARS-CoV-2, animals were observed for disease 
signs and scored according to a pre-established clinical scoring sheet (a). On 
clinical exams, bodyweight (b}, and body temperature (c) were measured. 
Respiration rate was measured, and breathing pattern was recorded, with 
irregular respiration patterns indicated in red (d). Ventro-dorsal and lateral 
radiographs were taken on clinical exam days and scored fort he presence of 
pulmonary infiltrates (0: normal; 1: mild interstitial pulmonary infiltrates; 2: 
4 I Nature I www.nature.com moderate pulmonary infiltrates perhaps with partial cardiac border 
effacement and small areas of pulmonary consolidation; 3: severe interstitial 
infiltrates, large areas of pulmonary consolidation, alveolar patterns and air 
bronchograms). Individual lobes were scored and scores per animal per day 
totaled (e). Grey: animalseuthanized 3 dpi; black: animals euthanized 2ldpi. 
Identical symbols have been used to denote identical animals throughout this 
manuscript. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710044
a Nose swabs Throat swabs 
8 8 e e 
Vi Vi as .. 6 'ii 
0 0 u u 
0 0 
Ci 4 Ci 4 g g 
"O "O 
"' "' 2 .2 .2 
~ ~ > 0 > 0 
0 5 10 15 20 0 5 10 15 
Days post inoculation Days post inoculation 
b 
BAL-RNA BAL-virus _10 -5 e e 
Vi 8 ~ 0 4 QI ID 'ii c 
0 0 u 6 I-3 0 0 
Ci Ci 
,g_4 g 2 
"O "O 
"' "' .2 2 .2 
~ ~ > 0 > 0 
0 2 4 0 4 
Days post inoculation Days post inoculation 
Fig. 21 Viral loads in respiratory samples and bodily fluids. After 
inoculation, nose, throat, rectal and urogenital swabs were collected; viral 
loads in these samples were determined by qRT-PCR (a). On 1. 3, and 5 dpi, 
bronchoalveolar lavages were performed on the 4 animals remaining in the 
study through 21 dpi;viral loads and virus titers were determined in these 20 Rectal swabs Urogenital swabs 
=:-8 =:-8 
E E 
Vi Vi ·as ·as 
0 0 u u 
0 0 
Ci 4 Ci 4 g g 
"O "O 
"' 2 .2 2 .2 
~ ~ > 0 > 0 
0 10 15 20 0 5 10 15 20 
Days post inoculation Days post inoculation 
c d 
Blood Urine 
=:-8 =:-8 
E E 
Vi Vi .. QI 
'ii 6 'ii 6 
0 0 u u 
0 0 
Ci 4 Ci 4 g g 
"O "O 
"' 2 "' 2 .2 .2 
~ ~ > 0 > 0 
0 5 10 15 20 21 
Days post inoculation Days post inoculation 
samples. Viral loads were determined in blood collected during clinical exams 
(c) and urine collected at necropsy on 3 and 21 (d). Grey: animals euthanized 3 
dpi; black: animals euthanized 2ldpi; red: virus was isolated from these 
samples. Identical symbols have been used to denote identical animals this 
manuscript. 
Nature I www.nature.com I 5 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710045
Article 
c 
50 
"C 
,2! 40 
~ UI 
iJ; -~ 30 
Ql UI 
~ ;,20 
-.c 0 10 
?ft. b 
3 dpi •3 dpi 
•21 dpi 
u m u m u m u m 
right lobe left lobe right lobe left lobe Days post 
inoculation 
ventral 
Fig. 31 Pathological changes in rhesus macaques infected with SARS-CoV-2. 
Four rhesus macaques were euthanized on 3 and 2ldpi. Grossly, lungs showed 
focal areasofhilarconsolidation and hyperemia (circles) on 3 dpi (a) and 
multifocal, random consolidation and hyperemia (circles) on 2ldpi (b). The 
percentage of the area of the lungs affected by gross lesions was estimated (c), 
and lung weight to bodyweight r-atio was calculated. (d). The dotted line 
represents baseline ratio calculated from an in-house collection ofrhesus 
macaque lung and bodyweiglits from animals with grossly normal lungs. 
Histological analysis was performed on tissues collected at 3 dpi (e·i). Tissue 
sections were colle'cted from the same anatomical location for each animal; 
three tissue sections were prepared from each oft he 6 lunglobes. In total, 18 
lung sections were evaluated for each animal; representative images are 
displayed. (e) Pulmonary vessels surrounded by moderate numbers of 
lymphocytes and fewer macrophages (arrows). (f) Alveoli filled with small to 
6 I Nature I www.nature.com dorsal 
moderate numbers of macrophages and neutrophils (asterisks). Adjacent 
alveolar interstitium (arrows) is thickened by edema, fibrin, neutrophils, 
lymphocytes and macrophages. (g) SARS·CoV -2 antigen detected by 
immunohistochemistry in type I pneumocytes. (h) Pulmonary vessels bounded 
by lymphocytes (arrowhead) and hyaline membranes (arrows) line alveolar 
spaces. (i) Hyaline membranes line alveoli (arrows). (j) SARS-CoV·2 antigen 
detected by immunohistochemistry in type I pneumocytes (asterisk) and type 
II pneumocytes (arrow) as well as alveolar macrophages (arrowheads) . (k) 
SARS-CoV-2 antigen detected by immunohistochemistry in macrophages in a 
mediastinal lymph node. (I) SARS·CoV-2 antigen detected by 
immunohistochemistry in macrophages and lymphocytes in the lamina 
propria of the cecum. (m) SARS-CoV·2 detected by immunohistochemistry in 
type 1 pneumocytes. Magnification : e, h lOOx; f, g, l,j, k, I 400x; m: lOOOx. u: 
upper; m: middle; I: lower. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710046
Methods 
Ethics and biosafety statement 
All animal experiments were approved by the Institutional Animal Care 
and Use Committee ofRocky Mountain Laboratories, NIH and carried 
out by certified staff in an Association for Assessment and Accredi­
tation of Laboratory Animal Care (AAALAC) International accred­
ited facility, according to the institution's guidelines for animal use, 
following the guidelines and basic principles in the NIH Guide for the 
Care and Use of Laboratory Animals, the Animal Welfare Act, United 
States Department of Agriculture and the United States Public Health 
Service Policy on Humane Care and Use of Laboratory Animals. Rhesus 
macaques were housed in adjacent individual primate cages allowing 
social interactions, in a climate-controlled room with a fixed light-dark 
cycle (12-hr light/12-hr dark). Animals were monitored at least twice 
daily throughout the experiment . Commercial monkey chow, treats, 
and fruit were provided twice daily by trained personnel. Water was 
available ad libitum. Environmental enrichment consisted ofa variety 
of human interaction, manipulanda, commercial toys, videos, and 
music. The Institutional Biosafety Committee (IBC) approved work 
with infectious SARS-CoV-2 strains under BSL3 conditions . Sample 
inactivation was performed according to !BC-approved standard oper­
ating procedures for removal of specimens from high containment . 
Study design 
To evaluate the use of rhesus macaques as a model for SARS-CoV-2, 
eight adult rhesus macaques (4 males, and4 females, age4-6 years) were 
inoculated via a combination of intranasal (0.5ml per nostril), intratra­
cheal (4ml),oral (lml) and ocular (0.25ml per eye) ofa 4xl05TCID50/ml 
(3xl08 genome copies/ml) virus dilution in sterile DMEM. The animals 
were observed twice daily for clinical signs of disease using a standard­
ized scoring sheet (Supplementary Information Table SI); the same 
person assessed the animals throughout the study. The predetermined 
endpoint for this experiment was 3 days post inoculation (dpi) for one 
group of 4 animals, and 21 dpi for the remaining 4 animals. Animals 
were randomly assigned to a group for necropsy prior to the start of the 
experiment . Blinding was not used in this study since all animals were 
subjected to the same treatment . Clinical exams were performed on 
0, 1, 3, 5, 7, 10, 12, 14, 17 and 21 dpi on anaesthetized animals. On exam 
days, clinical parameters such as bodyweight, body temperature and 
respiration rate were collected, as well as ventro-dorsal and lateral chest 
radiographs . Chest radiographs were interpreted by a board-certified 
clinical veterinarian . The following sampies were collected at all clinical 
exams: nasal, throat, urogenital and rectal swabs, blood. The total white 
blood cell count, lymphocyte, neutrophil, platelet, reticulocyte and 
red blood cell counts, hemoglobin, and hematocrit values were deter­
mined from EDTA blood with the IDEXX ProCyte DX analyzer (IDEXX 
Laboratories). Serum biochemistry (albumin, AST, ALT, GGT, BUN, 
creatinine) was analyzed using the Piccolo Xpress Chemistry Analyzer 
and Piccolo General Chemistry13 Panel discs (Abaxis). During clinical 
exams on 1, 3, and 5 dpi bronchoalveolar lavages were performed using 
lOml sterile saline. Of note, repeated bronchoalveolar lavages do not 
induce lung damage when space 48 hrs apart27•28• After euthanasia, 
necropsies were performed . The percentage of gross lung lesions was 
scored by a board-certified veterinary pathologist and samples oft he 
following tissues were collected: inguinal lymph node, axillary lymph 
node, cervical lymph node, salivary gland, conjunctiva, nasal mucosa, 
oropharynx, tonsil, trachea, all six lung lobes, mediastinal lymph node, 
right and left bronchus, heart, liver, spleen, pancreas, adrenal gland, 
kidney, mesenteric lymph node, stomach, duodenum,jejunum, ileum, 
cecum, colon, urinary bladder, reproductive tract (testes or ovaries 
depending on sex of the animal), bone marrow, frontal brain, cerebel­
lum and brainstem . Histopathological analysis of tissue slides was 
performed by a board-certified veterinary pathologist blinded to the 
group assignment of the animals. Virus and cells 
SARS-CoV-2 isolate nCoV-WAI-2020 (MN985325.1)14 (Vero passage 3) 
was kindly provided by CDC and propagated once in VeroE6 cells in 
DMEM (Sigma) supplemented with 2% fetal bovine serum (Gibco), 
1 mM L-glutamine (Gibco), 50 U/ml penicillin and 50 µg/ml streptomy­
cin (Gibco) (virus isolation medium). The used virus stock was 100% 
identical to the initial deposited genbanksequence (MN985325.1) and 
no contaminants were detected. VeroE6 cells were maintained in DMEM 
supplemented with 10% fetal calf serum, 1 mM L-glutamine, 50 U/ml 
penicillin and 50 µg/ml streptomycin. VeroE6 cells were provided by 
Dr. Ralph Barie and were not authenticated in-house; mycoplasma 
testing is performed at regular intervals and no mycoplasma has been 
detected. 
Quantitative PCR 
RNA was extracted from swabs and BAL using the QiaAmp Viral RNA 
kit (Qiagen) according to the manufacturer's ins-tructions . Tissues 
(30 mg) were homogenized in RLT buffer and RNA was extracted using 
the RN easy kit (Qiagen) according to the manufacturer's instructions . 
For detection of viral RNA, 5 µI RNA was used in a one-step real-time 
RT-PCR E assay29 using the Rotor-Gene probe kit (Qiagen) accord­
ing to instructions of the manufacturer. In each run, standard dilu­
tions of counted RNA standards were run in parallel, to calculate 
copy numbers in the samples. For detection ofSARS-CoV-2 mRNA, 
primers targeting open reading frame 7 (ORF?) were designed 
as follows: forward primer 5'-TCCCAGGTAACAAACCAACC-3', 
reverse primer 5'-G<ZTCACAAGTAGCGAGTGTTAT -3', and probe 
FAM-ZEN-CTTGTAGATCTGTTCTCTAAACGAAC-IBFQ . 5 µI RNA was 
used in a one-step real-time RT-PCR using the Rotor-Gene probe kit 
(<'.!iagen) according to instructions of the manufacturer. In each run, 
standard dilutions of counted RNA standards were run in parallel, to 
calculate copy numbers in the samples. 
Histopathology and immunohistochemistry 
Histopathology and immunohistochemistry were performed on 
rhesus macaque tissues. After fixation for a minimum of? days in 
10% neutral-buffered formalin and embedding in paraffin, tissue 
sections were stained with hematoxylin and eosin (HE). To detect 
SARS-CoV-2 antigen, immunohistochemistry was performed using 
an anti-SARS nucleocapsid protein antibody (Novus Biologicals) at a 
1:250 dilution. This antibody was first tested on SARS-CoV-2 infected 
and uninfected Vero E6 cell pellets, showing specific staining with 
infected cells and no staining with uninfected cells. The antibody 
showed specific staining with infected experimental tissue and no 
staining with uninfected tissue from rhesus macaques. Infected tissue 
and cell pellet specimens showed no staining when run with Rabbit 
IgG controls (non-specific rabbit IgG substituted for primary anti­
body). Stained slides were analyzed by a board-certified veterinary 
pathologist. 
Transmission electron microscopy. After fixation for 7 days with 
Karnovsky's fixative at4 °C, excised tissues were post-fixed for 1 hour 
with 0.5% osmium tetroxide/0.8% potassium ferricyanide in 0.1 M 
sodium cacodylate, washed 3 x 5 minutes with O.IM sodium caco­
dylate buffer, stained 1 hour with 1% tannic acid, washed with buffer 
and then further stained with2% osmium tetroxide in O.IM sodium 
cacodylate and overnight with 1% uranyl acetate at 4 °C. Specimens 
were dehydrated with a graded ethanol series with two final exchanges 
in 100% propylene oxide before infiltration and final embedding in 
Embed-812/Araldite resin. Thin sections were cut with a Leica EM 
UC6 ultra microtome (Leica, Vienna, Austria), prior to viewing at120 
kV on a Tecnai BT Spirit transmission electron microscope (Thermo 
fisher/FE!, Hillsboro, OR). Digital images were acquired with a Gatan 
Rio bottom mount digital camera system (Gatan Inc., Pleasanton, CA 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710047
Article 
and processed using Adobe Photoshop v. CC 2019 (Adobe Systems 
Inc, Sanjose, CA). 
Serum cytokine and chemokine analysis. Serum samples for analy­
sis of cytokine/chemokine levels were inactivated with y-radiation 
(2 M Rad) accordingtostandard operating procedures. Concentrations 
of granulocyte colony-stimulating factor, granulocyte-macrophage 
colony-stimulating factor, interferon (IFN)-y, interleukin (IL)-113. 
IL-1 receptor antagonist, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12/23 (p40), 
IL-13, IL-15, IL-17, MCP-1 and macrophage inflammatory protein 
(MIP)-la, MIP-ll), soluble CD40-ligand (sCD40L), transforming 
growth factor-a, tumor necrosis factor (TNF)-a, vascular endothe­
lial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200 
instrument (Bio-Rad) using the Non-Human Primate Cytokine MIL­
LIPLEX map 23-plex kit (Millipore) according to the manufacturer's 
instructions. 
Serology 
Sera were analyzed by SARS-CoV-2 spike protein (S) enzyme-linked 
immunosorbent assay (ELISA) as done previously for MERS-CoV30• 
Briefly, maxisorp (Nunc) plates were coated overnight with 100 ng/well 
S protein diluted in PBS31 (a kind gift of Barney Graham, Vaccine 
Research Center, NIH) and blocked with blocker casein in PBS (Life Tech­
nologies). Sera were serially diluted in duplicate. SARS-CoV-2-specific 
antibodies were detected using anti-monkey IgG polyclonal antibody 
HRP-conjugated antibody (KPL), peroxidase-substrate reagent (KPL) 
and stop reagent (KPL). Optical density (OD) was measured at405 nm. 
The threshold of positivity was calculated by taking the average oft he 
day 0 values multiplied by 3. 
For neutralization, sera were heat-inactivated (30 min, 56 °C) and 
two-fold serial dilutions were prepared in 2% DMEM. Hereafter, 100 
TCID50 ofSARS-CoV-2 was added. After 60 min incubation at 37 °C, 
virus:serum mixture was added to VeroE6 cells and incubated at 37 °C 
and 5% C02. At5 dpi, cytopathic effect was scored. The virus neutraliza­
tion titer is expressed as the reciprocal value of the highest dilution of 
the serum which still inhibited virus replication. All sera were analyzed 
in duplicate. Reporting summary 
Further information on research design is available in the Nature 
Research Reporting Summary linked to this paper. 
Data availability 
Data have been deposited in Figs hare: https://doi.org/10.35092/ 
yhjc.12026910. 
27. Haley, P. J., Muggenburg, B. A., Rebar, A.H., Shopp, G. M. & Bice, D. E. Bronchoalveolar 
lavage cytology in cynomolgus monkeys and identification of cytologic alteration s!' 
following sequential saline lavage. Vet Pathol 26, 265-273, https,//doi.org/ 
10.1177/030098588902600312 (1989). 
28. Krombach , F. et al. Short-term and long-term effects of serial bronchoalveolar lavages in 
a nonhuman primate model. Am J Respir Grit Care Med 150, 153-158, https,//doi.org/ 
10.1164/ajrccm.150.1.8025742 (1994). 
29. Corman, V. M. et al. Detection of 2019 novel coronavirus (-2019-nCoV) by real-time RT-PCR. 
Euro Surveill 25, httpsJ/doi.org/10.2807/1560-7917.ES.2020.25.3.2000045 (2020). 
30. van Doremalen, N. et al. High Prevalence of Middle East Respiratory Coronavirus in Young 
Dromedary Camels in Jordan. Vector Borne Zoonotic Dis 17, 55-159, httpsJ/doi.org/ 
10.1089/vbz.2016.2062 (2017). 
31. Wrapp, D. et al. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. 
Science 367, 1260-1263, httpsJ/doi.org/10.1126/science.abb2507 (2020). 
Acknowledgements The authors would like to thank Susan Gerber and Natalie Thornburg 
(CDC) for providing the SARS-CoV-2 isolate used in this study; Barney Graham, Kizzmekia 
Corbett and Olubukola Abiona at the Vaccine Research Center (NIAID, NIH) for providing spike 
protein for serology; Anita Mora (NIAID, Nib!) for help with figure design and staff of the Rocky 
Mountain Veterinary Branch (NIAID, NIH) for animal care. This study was supported by the 
Intramural Research Program, NIAID, NIH. 
Author contributions VJM and EdW designed the study; VJM, FF, BW, NvD, LPP, JS, KMW, AO, 
JC, BB, VAA, RR, PH, GS, EF, DS and EdW acquired, analyzed and interpreted the data; VJM, PH, 
EF, DS and EdW wrote the manuscript. All authors have approved the submitted version. 
Competing interests The authors declare no competing interests. 
Additional information 
.Supplementary information is available for this paper at https,//doi.org/10.1038/s41586-020-
2324-7. 
Correspondence and requests for materials should be addressed to E.d.W. 
Peer review information Nature thanks Wolfgang Baumgartner, Menno D. de Jong and Patricia 
Pesavento for their contribution to the peer review of this work. 
Reprints and permissions information is available at http://www.nature.com/reprints. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710048
Extended Data Fig. I I Pulmonary infiltrates in a rhesus macaque after 
inoculation. Radiographs show the progression of pulmonary infiltrates 
throughout the study in a single animal. Of note, this animal is denoted with a 
black triangle throughoutthe manuscript. Circles indicate areas of mild to moderate pulmonary infiltrates. A marker'R' indicates right side of the animal. 
Three chest radiographs were taken at each timepoint: right-lateral, left-lateral 
and ventro-dorsal; only the ventro-dorsal radiograph is shown. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710049
Article 
25 
~20 :i g 15 White blood cells 
~ 10 f]' ~-------=t~~ ::::---­
$: 5 
o+--~-~--~-~ 
0 10 15 20 
Days post inoculation 
Hematocrit 
;,::~ 
~E~ 
0 5 10 15 20 
Days post inoculation Neutrophils 
Days post inoculation 
Red blood cells 
Days post inoculation 
Extended Data Fig. 21 Hematological changes in rhesus macaques infected 
with SARS-CoV-2. Identical symbols have been used to denote identical Lymphocytes 
io~l~~ 
~~ 
0 5 10 15 20 
Days post inoculation 
Hemoglobin 
0 5 10 15 20 
Days post inoculation '3: 300 g 
Ill 200 
~ u 
0 :; 
u 
~ 0 Monocytes 
10 15 
Days post inoculation 
Reticulocytes 
5 10 15 20 
Days post inoculation 
animals throughout the figures in this manuscript. n= 8 animals on 0, 1, and 3 
dpi and n=4 animals thereafter. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710050
15000 
~10000 
.e: 
~ ";' 5000 
:::! p=<0.0001 
5 IL-1ra 
10 15 
Days post inoculation 
MCP-1 
10000 p=<0.0001 
~ 8000 
~ 6000 
0.. 4000 20 
~ 2000 ~ 
o.f-..c1:,,..,...,=t-...,,,,...,.,,._ ~ 
0 5 10 15 20 
Days post inoculation 80 
"E 60 Ci 
~ 40 
-;[_ 20 
:E IL-6 
5 10 15 
Days post inoculation 
MIP-1b 
5 10 15 
Days post inoculation 
Extended Data Fig. 31 Cytokine and chemokine levels in serum of rhesus 
macaques infected with SARS-CoV-2. The levels of23 cytokines and 
chemokines were determined in serum at different timepoints after 
inoculation. Levels are displayed only for those cytokines and chemokines 
where statistically significant (1-way A NOVA) we re observed compared to 20 
20 IL-10 
1500 p=0.0137 
~1000 
.e: 
0 
~ 500 
20 
"E 15 
~ -10 
~ 5 10 15 
Days post inoculation 
TGFa 
~ 5.U~-.:::t~~"11'-.C*~ 
5 10 15 
Days post inoculation 20 
20 80 
~ 60 
Ci .e: 40 
It> 
~ 20 IL-15 
p=<0.0001 
5 10 15 20 
Days post inoculation 
levels on day of inoculation. Identical symbols have been used to denote 
identical animals throughout the figures in this manuscript . The lower limit of 
detection is indicated with a dotted line. Serum samples were analyzed in 
duplicate from each animal for each timepoint; n= 8 animals on 0, 1, and 3 dpi 
and n=4 animals thereafter . 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710051
Article 
Extended Data Fig. 41 Histological lesions in lungs of a rhesus macaque 
infectedwithSARS-CoV-2. (a) This low magnification figure displays the focal 
natureofSARS-CoV-2 lesions in the lungs of animals euthanized on 3 dpi. The 
circle indicates the lung affected by lesion; the remaining lung tissue is healthy. 
(b) Lymphocytes surround pulmonary vessels. Magnification SO Ox. Tissue sections were collected from the same anatomical location for each animal; 
three tissue sections were prepared from each of the 6 lung lobes. In total, 18 
lung sections were evaluated for each animal (n=4); representative images are 
displayed . 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710052
Extended Data Fig. 51 Histological changes in the respiratory tract of 
rhesus macaques infected with SARS-CoV-2. (a) Squamous metaplasia of 
nasal turbinate respiratory epithelium (arrow). Magnification400x. (b) 
SARS-CoV-2 antigen is detected by immunohistochemistry in respiratory 
epithelium of the nasal turbinate. Magnification 400x. (c) Essentially normal 
tonsil. Magnification 400x. (d) SARS-CoV-2 antigen is detected by 
immunohistochemistry in tonsillar macrophages. Magnification 400x. (e) Squamous metaplasia of tracheal columnar epithelium (arrow). Magnification 
400x. (f) SARS-CoV-2 antigen is detected by immunohistochemistry in tracheal 
columnar epithelium . Magnification 400x. Tissue sections were collected 
from the same anatomical location for each animal (n=4) and organ; one tissue 
section was evaluated of the nasal turbinates of each animal; three tissue 
sections were evaluated from tonsil and trachea. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710053
Article 
Extended Data Fig. 6 I SARS-CoV-2 antigen in the gastrointestinal tract of a 
rhesus macaque infected with SARS-CoV-2. Mononuclear cells staining 
positive for SARS-CoV-2 antigen in the lamina propria of stomach (a), 
duodenum (b),jejunum (c), ileum (d), cecum (e) and colon (f) of an animal infected with SARS-CoV-2 and euthanized on 3dpi. Tissue sections were 
collected from the same anatomical location for each animal (n=4) and organ; 
three tissue sections were evaluated from each animal and organ. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710054
Extended Data Fig. 71 Ultrastructural analysisoflungs of rhesus macaques 
infected with SARS-CoV-2. Lung tissue collected on 3 dpi was analyzed by 
transmission electron microscopy. The alveolar interstitium is expanded by 
edema (E), fibrin (F) and mononuclear (M) inflammatory cells (a). Normal 
collagen fibers (c) and multiple virions (arrowheads) line type I pneumocytes (arrows). Boxes in (a) indicate areas enlarged in (b-d). Scale bar in (a) represents 
2µm, scale bars in (b·e) represent 0.2 µm. Three tissue samples were collected 
from each animal (n=4) and cut into 6 samples for analysis; a minimum of2 
samples wereianalyzed per animal (n=4). 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710055
Article 
a 
_ 10 
~ 
~ 
-~ 
~ 
" 0 
"§ > 
c 
~ 
~ 
·~ 
"' 0 
" .2 
"§ 
> • . 
• .. • .. . ... ... . .. .. . • • 
upper middle lower upper middle lower 
right lobe left lobe 
• • • b 10 
T • • .... .... • 
Nasal OropharynxTrachea R 
muscosa Bronchus Bronchus 
• • • 
Inguinal Axillary Cervical MediastinalMesenteric Tonsil Spleen Bone marrow 
LN LN LN LN LN 
d e 
4 
"E 
~ 
~ I 
~ 
-~ -~ 
• • "' 0 
"' 0 • 0 
" " .2 .2 
"§ 
> ;; 
$ 
Stomach Duodenum Jejunum Ileum Cecum Colon Frontal Cerebellum Brainstem 
brain 
• 
• • 
Salivary Conjunctiva Heart Liver Pancreas Adrenal Kidney Urinary Reproductive 
gland 
g 
... .. . . 
3 3 3 " i ·~ j 3 ~ ..J ..J ..J ..J ..J f " :; ..J 3 :: ;; "' ~ c, ~ ~ ::c "' 0: 0: 
I -~ ;:- ~ : ·x 
.~ -~ g-
"' 0 0 ii 
~ 0 
~ 
Extended Data Fig. 81 Viral loads in tissues collected from rhesus macaques 
infected with SARS-CoV-2. Eight adult rhesus macaques were inoculated with 
SARS-CoV -2 isolate nCoV-WAl-2020 and euthanized on 3 (n=4) and 21 (n=4) dpi. 
Thirty-seven tissues were collected at necropsy and analyzed for the presence 
of viral RNA by qRT-PCR. Tissues are grouped by lung lobes collected on 3 dpi 
(a), with red symbols indicating tissues from which virus could be isolated in 
Vero E6 cells; other tissues from the respiratory tract on 3dpi (b); lymphoid 
tissues on 3 dpi (c);gastrointestinal tissueson 3 dpi (d); the central nervous ..J ..J ..J gland bladder tract 
~ " >. 3 ! j § 0 ~ " ::; 
~ c, " u ~ 0 " g c " 0 0 
~ ~ ~ ~ :;; l 
~ ~ ~ ~ 
cl! 
ii: "' :; :5 
system on 3 dpi (e); remaining tissues on 3 dpi (f); and all tissues collected on 21 
dpi (g)_ Blue symbols in b-g indicate that viral mRNA was also detected in these 
tissues. Identical symbols have been used to denote identical animals 
throughout the figures in this manuscript . LN: lymph node; RUL: right upper 
lung lobe; RML: right middle lung lobe; RLL: right lower lung lobe; LUL: left 
upper lung lobe; LML: left middle lung lobe; LLL: left lower lung lobe; R: right; L: 
left. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710056
a b 
3200 
~ 80 
c: 
0 
2 2400 ~ 60 :;::; .!::! < ~ Ill :J :; w ., 
;;; 1600 c: 40 
"' CJ ::I 0 ·$ ii ·;::; 800 ;;; 20 ., CJ 0:: 0 ii ·;::; 
<100 ., <10 0:: 
0 5 10 15 20 0 5 10 15 20 
Days post inoculation Days post inoculation 
Extended Data Fig. 91 Antibody response in rhesus macaques infected with antibodies in a microneutralization assay (b). All sera were analyzed in 
SARS-CoV-2. Sera collected after inoculation were tested for the presence of duplicate . Identical symbols have been used to denote identical animals 
lgG against SARS-CoV-2 spike in ELISA (a) and for the presence of neutralizing throughout the figures in this manuscript. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710057
Article 
Extended Data Table 11 Clinical signs observed in rhesus macaques inoculated with SARS-CoV-2 
Animal Clinical signs observed 1-6 dpi Clinical signs observed 7-21 dpi Observations at necropsy* 
RM1 
-R_M_2~~~~P-ilo_e_r-ec-t-io-n-;d_y_s_p-ne_a_;_r-ed_u_c_e_d_a_p_p_e_tit_e_·~~-N- /-A~~~~~~~~~~~~~~~~F-lu-id---fil-le_d_s-to-m~ac_h_ ._s_m_a_ll_a_n_d~~ "~ ~.....,,,,.. Euthanized 3 dpi. large intestine. ~ 
RMJ Piloerection; tachypnea; flushed N/A Epistaxis. Gross lung lesions. 
appearance ; reduced appetite; mildly Enlarged mediastinal lymph nodes. 
RM4 
RMS 
RM6 
RM7 
RMB dehydrated. Fluid-filled stomach, small and 
Euthanized 3 dpi. large intestine. 
Hunched posture; piloerection; tachypnea ; 
dyspnea; reduced appetite. 
Euthanized 3 dpi. 
Hunched posture; piloerection; tachypnea ; 
dyspnea; reduced appetite. 
Hunched posture; piloerection; tachypnea ; 
dyspnea; reduced appetite; serous nasal 
discharge. 
Hunched posture; piloerection ; pale 
appearance ; tachypnea ; dyspnea; irregular; 
labored respirations ; anorexia; mildly 
dehydrated ; serous nasal discharge. 
Hunched posture; piloerection; pale 
appearance ; increased , dyspnea; reduced 
appetite; serous nasal discharge. N/A 
Tachypnea; dyspnea; reduced appetite; 
mildly dehydrated. 
Recovered on 9 dpi. 
Piloerection ; bradypnea; mildly de~ydrated; 
crusty nasal discharge. I 
Recovered on 10 dpi. 
Hunched posture; piloerection; pale 
appearance ; tachypnea ; dyspnea; reduced 
appetite; mildly dehydrated; crusty nasal 
discharge. 
Recovered on 17 dpi. 
Hunched posture; piloerection; pale 
appearance; increased , dyspnea; nasal 
discharge; reduced appetite; mildly 
dehydrated ; serous nasal discharge. 
Recovered on 13 dpi. Gross lung lesions. Foamy exudate 
from trachea. 
Enlarged mediastinal lymph nodes. 
Fluid-filled stomach, small and 
large intestine. 
Gross lung lesions. 
Enlarged mesenteric lymph nodes. 
None. 
None. 
Gross lung lesions. 
*Incidental observations not related to coronavirus infection were o itted from this table. 
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710058