Document text
nature https://doi.org/10 .1038/s41586-020-2324-7
Accelerated Article Preview
Respiratory disease in rhesus macaques
inoculated with SARS-CoV-2
Received : 22 March 2020
Accepted: 1 May 2020
Accelerated Article Preview Published
on line 12 May 2020
Cite this article as: Munster, V. J. et al.
Respiratory disease in rhesus macaques
inoculated with SARS-CoV-2. Nature
https://doi.org/10.1038/s41586-020-2324-7
(2020). Vincent J. Munster, Friederike Feldmann, Brandi N. Williamson, Neeltje van Doremalen,
Lizzette Perez-Perez, Jonathan Schulz, Kimberly Meade-White, Atsushi Okumura,
Julie Callison, Beniah Brumbaugh, Victoria A. Avanzato, Rebecca Rosenke, Patrick W. Hanley,
Greg Saturday, Dana Scott, Elizabeth R. Fischer & Emmie de Wit
This is a PDF file of a peer-reviewed paper that has been accepted for publication.
Although unedited, the content has been subjected to preliminary formatting. Nature
is providing this early version of the typeset paper as a service to our authors and
readers. The text and figures will undergo copyediting and a proof review before the
paper is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers
apply.
Nature I www.nature.com
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710040
Article
Respiratory disease in rhesus macaques
inoculated with SARS-CoV-2
https://doi.org/10.1038/s41586-020-2324-7
Received: 22 March 2020 Vincent J. Munster', Friederike Feldmann2, Brandi N. Williamson', Neeltje van Doremalen',
Lizzette Perez-Perez', Jonathan Schulz', Kimberly Meade-White', Atsushi Okumura',
Julie Callison', Beniah Brumbaugh3, Victoria A. Avanzato', Rebecca Rosenke2,
Accepted: 1 May 2020 Patrick W. Hanley2, Greg Saturday2, Dana Scott', Elizabeth R. Fischer3 & Emmie de Wit'~
Published on line: 12 May 2020
An outbreak of a novel coronavirus, named SARS·CoV·2, causing respiratory disease
and a -2% case fatality rate started in Wuhan, China in December 20191•2• Following
unprecedented global spread3, the World Health Organization declared COVID· 19 a
pandemic on March 11, 2020. Although data on disease in humans are emerging at a
steady pace, certain aspects of the pathogenesis ofSARS·CoV·2 can only be studied in
detail in animal models, where repeated sampling and tissue collection is possible.
Here, we show that SARS·CoV·2 causes respiratory disease in infected rhesus
macaques, with disease lasting 8· 16 days. Pulmonary infiltrates, a hallmark of human
disease, were visible in lung radiographs. High viral loads were detected in swabs from
the nose and throat of all animals as well as in bronchoalveolar lavages; in one animal
we observed prolonged rectal shedding. Taken together, the rhesus macaque
recapitulates moderate disease observed in the majority of human cases. The
establishment of the rhesus macaque as a model ofCOVID·19 will increase our
understanding of the pathogenesis of this disease and will aid development and
testing of medical countermeasures.
SARS-CoV -2 infection in humans can be asymptomatic or result in mild
to fatal Coronavirus Disease2019 (COVID-19)4-6• Patients with COVID-19
pneumonia presented mainly with fever, fatigue, dyspnea and cough7-9•
Rapidly progressing pneumonia, with bilateral opacities on x-ray or
patchy shadows and ground glass opacities by CT scan were observed in
COVID-19 patients2•6•10• Older patients with comorbiditiesare at highest
risk for adverse outcome ofCOVID-195.7. SARS-CoV-2 has been detected
in upper and lower respiratory tract samples from patients, as well as
feces and blood, but not in urine5•11-13•
Non-human primate models that recapitulate aspects of human
disease are essential forour understanding of the pathogenic processes
involved in severe respiratory disease and the development of medical
countermeasures such as vaccines and antivirals.
Clinical, respirator disease
Eight adult rhesus macaques were inoculated with SARS-CoV-2 isolate
nCoV-WAl-202014• On day 1 post inoculation (dpi), all animals showed
changes in respiratory pattern and piloerection, as reflected in their
clinical scores (Fig. la). Other observed signs of disease included
reduced appetite, hunched posture, pale appearance and dehydration
(Extended Data Table 1). Coughing was occasionally heard in the room
where animals were housed but could not be pinpointed to individual
animals. Disease signs persisted for more than a week, with all animals
completely recovered between 9and17 dpi (Fig. la and Table Sl). Weight
loss was observed in all animals (Fig. lb); body temperatures spiked on 1 dpi but returned to normal levels thereafter (Fig. le). Under anesthesia,
the animals did not show increased respiration; however, all animals
showed irregular respiration patterns (Fig. Id). Radiographs showed
pulmonary infiltrates in all animals starting on 1 dpi with mild pulmo
nary infiltration primarily in the lower lung lobes. By3 dpi, progression
of mild pulmonary infiltration was noted into other lung lobes although
still primarily in the caudal lung lobes (Fig. le). In one animal, pulmonary
infiltrates were observed from 1-12 dpi (Extended Data Fig. I).
Hematologic analysis of blood collected during clinical exams
showed evidence of a stress leukogram15by1 dpi in the majority of
animals (Extended Data Fig. 2). Lymphocytes and monocytes returned
to baseline after 1 dpi. Neutrophils decreased in all animals by 3 dpi
and continued to decline through 5 dpi; neutropenia was observed in
2 of 4 animals. On 1 dpi, decreased hematocrit, red blood cell counts
and hemoglobin were observed in all animals (Extended Data Fig. 2). In
addition, reticulocyte percentages and counts decreased. At 5 dpi, two
of four animals had a normocytic, normochromic non-regenerative
anemia consistent with anemia of critical illness; animals did not
return to their original baselines by 21 dpi. Blood chemistry analysis
revealed no values outside normal range (Supplementary Information
TableS2).
Serum was analyzed for changes in cytokine and chemokine levels at
different time points after inoculation . Statistically significant changes
wereonlyobserved onldpi, with increases in I Ura, IL6, ILlO, IUS, MCP-1.
MIP-lb, and on 3 dpi a small but statistically significant decrease in
TGFa was observed (Extended Data Fig. 3 ). Although changes occurred
'Laborator y of Virology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton , MT, USA. 'Rocky Mountain Veterinary Branch, National Institute of Allergy
and Infectious Diseases, National Institutes of Health, Hamilton , MT, USA. 'Research Technologies Branch, National Institute of Allergy and Infectious Diseases, National Institutes of Health,
Hamilton , MT, USA. ""e-mail, [email protected]
Nature I www.nature.com I 1
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710041
Article
in the levels of some of these cytokines later after inoculation, these
were not statistically significant (Extended Data Fig. 3).
High viral loads in respiratory samples
Virus shedding was highest from the nose (Fig. 2a); virus could be iso·
lated from swabs collected on 1and3 dpi, but not thereafter. Viral loads
were high in throat swabs immediately after inoculation but were less
consistent than nose swabs thereafter; in one animal throat swabs were
positive on 1 and IO dpi but not in between (Fig. 2a). One animal showed
prolonged shedding of viral RNA in rectal swabs; infectious virus could
not be isolated from these swabs (Fig. 2a) and intestinal tract disease
(e.g. diarrhea) was not observed . Urogenital swabs remained negative
in all animals throughout the study. On 1, 3 and 5 dpi bronchoalveolar
lavages (BAL) were performed on the 4animals in the group euthanized
on 21 dpi. High viral loads were detected in BAL fluid in all animals on
all three time points; infectious virus could only be isolated in BAL
fluid collected on 1and3 dpi (Fig. 2b). No viral RNA could be detected
in blood (Fig. 2c) or urine (Fig. 2d).
Interstitial pneumonia
On 3 and 2ldpi, one group of 4 animals was euthanized and necropsies
were performed.
On 3 dpi, varying degrees of gross lung lesions were observed in all
animals (Fig. 3a and c). By 21 dpi, gross lesions were still visible in the
lungs of2 of 4 animals (Fig. 3b and c). Additionally, all animals had an
increased lungweight:bodyweight ratio (Fig. 3d) as compared to healthy
rhesus macaques, indicative of pulmonary edema. Histologically, 3 of
the4animals euthanized on 3 dpi developed some degree of pulmonary
pathology . Lesions were multifocal (Extended Data Fig. 4a), mild to
moderate, interstitial pneumonia that frequently centered on terminal
bronchioles . The pneumonia was characterized by thickening of alveolar
septae by edema fluid and fibrin and small to moderate numbers of
macrophages and fewer neutrophils. Lungs with moderate changes also
had alveolar edema and fibrin with formation ofhyaline membranes.
There was minimal type II pneumocyte hyperplasia . Occasionally, bron·
chioles showed necrosis, loss and attenuation of the epithelium with
infiltrates of neutrophils, macrophages and eosinophils . Multifocally,
there were perivascular infiltrates of small numbers of lymphocytes
forming perivascular cuffs (Extended Data Figure 4b) and minimal to
mild, multifocal hyperplasia ofbronchiolar associated lymphoid tissue.
Three of 4 animals on 3 dpi had fibrous adhesions of the lung to the
pleura. Histologic evaluation showed these to be composed of mature
collagen interspersed with small blood vessels; therefore, this is most
likely a chronic change rather than related to SARS-CoV-2 infection.
Minimal to mild inflammation was observed in the upper airways with
multifocal squamous metaplasia of the respiratory epithelium with
infiltration of small numbers of neutrophils (Extended Data Figure 5).
lmmunohistochemistry using a mAb against SARS-CoV demon
strated viral antigen in small numbers of type I and II pneumocytes,
as well as alveolar macrophages. Antigen-positive macrophages were
detected in mediastinal lymph nodes of3 of 4 animals (Fig. 3k). lnter
estingly, small numbers of antigen-positive lymphocytes and mac
rophages were also detected in the lamina propria of the intestinal
tract of all 4 animals. In one animal, all collected tissues of the gas
trointestinal tract showed these antigen-positive mononuclear cells
(Extended Data Figure 6).
Ultrastructural analysis of lung tissue by transmission electron
microscopy confirmed the histologic diagnosis of interstitial pneu
monia. The alveolar interstitial space was greatly expanded by edema,
fibrin, macrophages and neutrophils (Extended Data Figure ?a). The
subepithelial basement membrane was unaffected and maintained
a consistent thickness and electron density. Occasionally, type
I pneumocytes are separated from the basement membrane by edema;
2 I Nature I www.nature.com the resulting space may contain virions. Affected type I pneumocytes
are lined by small to moderate numbers ofvirions 90-160 nm in diam
eter with an electron dense core bound by a less dense caps id (Extended
Data Figure 7b-e). Alveolar spaces adjacent to affected pneumocytes
are filled with a granular, moderately electron dense material that is
consistent with edema fluid.
Replication in the respiratory tract
All tissues (n=37) collected at necropsy were analyzed for the presence
of viral RNA. On 3 dpi, high viral loads were detected in the lungs of all
animals (Extended Data Fig. Sa); virus could be isolated from the lungs
of all 4 animals at this time. Additionally, viral RNA could be detected in
other samples throughout the respiratory tract (Extended Data Fig. 8),
as well as in lymphoid and gastrointestinal tissues. Viral RNA could not
be detected in major organs including the central nervous system. To
distinguish viral RNA derived from respiratory secretions from active
virus replication, all samples with presence of viral RNA were also tested
for the presence of viral mRNA (Extended E>ata Fig. 8). Viral mRNA was
detected in all respiratory tissues but could not in any but one of the
gastrointestinal tissues, indicating that virus replication in these tissues
seems unlikely, although we can't exclude it due to limited sample size.
By 21 dpi, viral RNA, but not mRNA, could still be detected in tissues
from all 4 animals (Extended Data Fig. Sg).
Serology
Serum was analyzed forthe development oflgG against SARS-CoV spike
in ELISA. By IO dpi, all four animals had seroconverted to SARS-CoV-2
spike;neutralizing responses also started to appear at IO dpi (Extended
Data Figure 9). Interestingly, the animal with the lowest and latest
neutralizing antibody response was the animal with prolonged viral
shedding from the intestinal tract.
Discussion
COVID-19 clinical manifestations range from asymptomatic to mild to
severe5•6·8·9·13·16. Patients present with influenza-like symptoms such as
fever and shortness of breath and may develop pneumonia requiring
mechanical ventilation and support in an intensive care unit9. Similar
to SARS-CoV and MERS-CoV, comorbidities such as hypertension and
diabetes play an important role in adverse outcome ofCOVID -198.17·18•
Advanced age and chronic conditions in particular are indicators of a
negative outcomes.7 -9·16, conditions that were absent in our healthy rhe
sus macaques . An analysis ofI099 COVID-19 cases from China showed
that approximately 5% of diagnosed patients developed severe pneu·
monia requiring ICU attendance, 2-3% required mechanical ventila
tion and 1.4% died9. The transient, moderate disease observed here in
rhesus macaques is thus in line with the majority of human COVID-19
cases. Pulmonary infiltrates on radiographs, a hallmark of human infec
tion2.4·6·7·9·10.16, were observed in all macaques. The shedding pattern
observed in rhesus macaques is strikingly similar to that observed
in humans11·u. In humans, consistent high SARS-CoV-2 shedding was
observed from the upper and lower respiratory tract, frequent inter
mediate shedding from the intestinal tract and sporadic detection in
blood5• Similar to humans, shedding ofSARS-CoV-2 continued after
resolution of clinical symptoms and radiologic abnormalities19. Limited
histopathology is available from COVID-19 patients20·21. Our analy
sis of the histopathological changes observed in the lungs of rhesus
macaques, suggests that they resemble those observed with SARS-CoV
and MERS-CoV21-24, with regard to lesion type and cell tropism.
Serological responses in humans are not typically detectable
before 6 days after symptom onset, with lgG titers between IOO and
I0,000 observed after 12 to 21 days25·26. Neutralizing titers were gen·
erally between 20 -160. This corresponds to the results in our rhesus
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710042
macaque model, where lgG responses were detected around 7-10 dpi.
Seroconversion was not directly followed by a decline in viral loads, as
observed in COVID-19 patients25•26•
Taken together, the rhesus macaque model recapitulates COVID-19,
with regard to virus replication and shedding, the presence of pulmo
nary infiltrates, histological lesions and seroconversion . This extensive
dataset allows us to bridge between the rhesus macaques model and
the disease observed in humans and to utilize this animal model to
assess the efficacy of medical countermeasures.
Online content
Any methods, additional references, Nature Research reporting sum
maries, source data, extended data, supplementary information,
acknowledgements, peer review information; details of author con
tributions and competing interests; and statements of data and code
availability are available at https://doLorg/10.1038/s41586-020-2324-7.
1. Wu, F. et al. A new coronavirus associated with human respirator y disease in China.
Nature, httpsJ/doi.org/10.1038/s41586-020-2008-3 (2020).
2. Zhu, N. et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J
Med 382, 727-733, https,ffdoi.org/10.1056/NEJMoa2001017 (2020).
3. Organization, W. H. Coronavirus disease (COVID-2019) situation reports, httpsJ/www.who.
int/emergencies/diseases/novel-coronavirus-2019/situation-reports/ (2020).
4. Yang, W. et al. Clinical characteristics and imaging manifestations of the 2019 novel
coronavirus disease (COVI0-19),A multi-center study in Wenzhou city, Zhejiang, China.
J Infect, httpsJ/doi.org/10.1016/j.jinf.2020.02.016 (2020).
5. Yang, X. et al. Clinical course and outcomes of critically ill patients with SARS-CoV-2
pneumonia in Wuhan, China: a single-centered, retrospective , observational study.
Lancet Respir Med, httpsJ/doi.org/10.1016 /S2213-2600(20)30079-5 (2020).
6. Silverstein, W. K., Stroud, L., Cleghorn, G. E. & Leis, J. A. First imported case of 2019 novel
coronavirus in Canada, presenting as mild pneumonia. Lancet 395, 734, httpsJ/doi.org/
10.1016/S0140-6736(20)30370-6 (2020).
7. Arentz, M. et al. Characteristics and Outcomes of 21 Critically Ill Patients With COVI0-19 in
Washington State. JAMA, httpsJ/doi.org/10.1001/jama.2020.4326 (2020).
8. Zhou, F. et al. Clinical course and risk factors for mortality of adult inpatients with
COVID-19 in Wuhan, China, a retrospective cohort study. Lancet, https,//doi.org/10.1016/
S0140-6736(20)30566-3 (2020).
9. Guan, W. J. et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N Engl J
Med, https,//doi.org/10.1056/NEJMoa2002032 (2020).
10. Shi, H. et al. Radiological findings from 81 patients with COVID-19 pneumonia in Wuhan,
China, a descriptive study. Lancet Infect Dis, httpsJ/doi.org/10.1016/S1473-3099(20)
30086-4 (2020).
11. Zou, L. et al. SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients.
N Engl J Med, https,ffdoi.org /10.1056/NEJMc2001737 (2020). 12. Kim, J. Y. et al. Viral Load Kinetics of SARS-CoV-2 Infection in First Two Patients in Korea.
J Korean Med Sci 35, e86, httpsJ/doi.org/10.3346/jkms.2020.35.e86 (2020).
13. Tang, A. et al. Detection of Novel Coronavirus by RT-PCR in Stool Specimen from
Asymptomatic Child, China. Emerg Infect Dis 26, https,//doi.org/10.3201/eid2606.200301
(2020).
14. Harcourt , J. et al. Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with
2019 Novel Coronavirus Disease, United States. Emerg Infect Dis 26, httpsJ/doi.org/
10.3201/eid2606.2005 16 (2020).
15. Everds, N. E. et al. Interpreting stress responses during routine toxicity studies: a review of
the biology, impact, and assessment. Toxicol Pathol 41, 560-614, https,ffdoi.org/
10.1177/0192623312466452 (2013).
16. Wang, D. et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel
Coronavirus-lnfected Pneumonia in Wuhan, China. JAMA, httpsJ/doi.org/10.1001/
jama.2020.1585 (2020).
17. Assiri, A. et al. Epidemiological, demographic, and clinical characteristics of 47 cases of
Middle East respiratory syndrome coronavirus disease from Saudi Arabia: a descriptive
study. Lancet Infect Dis 13, 752-761, httpsJ/doi.org/10.1016/S1473-3099(13)70204-4
(2013).
18. Booth, C. M. et al. Clinical features and short-term outcomes of 144 patients with SARS in
the greater Toronto area. JAMA 289, 2801-2809, https,ffdoi.org/10.1001/jama.289.21.
JOC30885 (2003).
19. Lan, L. et al. Positive RT-PCR Test Results in Patients Recovered From COVID-19. JAMA,
httpsJ/doi.org/10.1001/jama.2020.2783 (2020).
20. Tian, S. et al. Pulmonary Pathology of Early-Phase 2019 Nov.el Coronavirus (COVID-19)
Pneumonia in Two Patients With Lung Cancer. J Thorac Oneal, httpsJ/doi.org/10.1016/j.
jtho.2020.02.010 (2020).
21. Xu, Z. et al. Pathological findings of COVID-19 associated with acute respiratory
distress syndrome. Lancet Respir Med, https,ffdoi.org/10.1016/S2213-2600(20)
30076-X (2020).
22. Ng, D. L. et al. Clinicopathologic, lmmunohist ochemical, and Ultrastructural Findings of a
Fatal Case of Middle East Respiratory Syndmme Coronavirus Infection in the United Arab
Emirates, April 2014. Am J Pathol 186, 652-658, httpsJ/doi.org/10.1016/j.ajpath.
2015.10.024 (2016).
23. Nicholls, J.M. et al. Lung pathology of fatal severe acute respiratory syndrome.
Lancet 361, 1773-1778, https,//doi.org/10.1016/s0140-6736(03)13413-7 (2003).
24. Ding, Y. et al. The clinical pathology of severe acute respiratory syndrome (SARS),
a report from China. J Pathol 200, 282-289, httpsJ/doi.org/10.1002/path.1440
(2003).
25. Roman Welfel' Victor M. Corman, W. G., Michael Seilmaier, Sabine Zange, Marcel A.
Muller, Daniela Niemeyer , Terence C. Jones Kelly, Patrick Vollmar, Camilla Rothe, Michael
Hoelscher , Tobias Bleicker, Sebastian Brunink, Julia Schneider, Rosina Ehmann, Katrin
Zwirglmaier, Christian Drosten, Clemens Wendtner. Virological assessment of
hospitalized cases of coronavirus disease 2019. MEDRXIV (2020).
26. Zhao, Y., Wang, Liu, Liao, Su, Wang, Yuan, Li, Li, Qian, Hong, Wang, Liu, Wang, He, Li, He,
Zhang, Ge, Liu, Zhang, Xia, Zhang. Antibody responses to SARS-CoV-2 in patients of novel
coronavirus disease 2019. medRxiv (2020).
Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
©This is a U.S. government work and not under copyright protection in the U.S.; foreign
copyright protection may apply 2020
Nature I www.nature.com I 3
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710043
Article
a 30 b 105
~ 20
u
"' Cii u
:5 u 10 ., ~ ·= 100 Qi
"' .. -"
~ 95 ~ :E
"' ·a;
l: 90 ..,
'C 0
[II
85
10 15 20 0 10 15 20
Days post inoculation Days post inoculation
c d e
~ 80 4
:I c:
:§ 60 "' .s:: ..
~ e 40
c:
0 :;::;
E ·a. 20 ~
0 3 u
"' .s:: a. E 2 "' 0
=c ..
Cl:
"' .,
Cl:
0
10 15 20 5 10 15 20
Days post inoculation Days post inoculation Days post inoculation
Fig. I I Rhesus macaques infected with SARS-CoV-2 develop respiratory
disease. After inoculation with SARS-CoV-2, animals were observed for disease
signs and scored according to a pre-established clinical scoring sheet (a). On
clinical exams, bodyweight (b}, and body temperature (c) were measured.
Respiration rate was measured, and breathing pattern was recorded, with
irregular respiration patterns indicated in red (d). Ventro-dorsal and lateral
radiographs were taken on clinical exam days and scored fort he presence of
pulmonary infiltrates (0: normal; 1: mild interstitial pulmonary infiltrates; 2:
4 I Nature I www.nature.com moderate pulmonary infiltrates perhaps with partial cardiac border
effacement and small areas of pulmonary consolidation; 3: severe interstitial
infiltrates, large areas of pulmonary consolidation, alveolar patterns and air
bronchograms). Individual lobes were scored and scores per animal per day
totaled (e). Grey: animalseuthanized 3 dpi; black: animals euthanized 2ldpi.
Identical symbols have been used to denote identical animals throughout this
manuscript.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710044
a Nose swabs Throat swabs
8 8 e e
Vi Vi as .. 6 'ii
0 0 u u
0 0
Ci 4 Ci 4 g g
"O "O
"' "' 2 .2 .2
~ ~ > 0 > 0
0 5 10 15 20 0 5 10 15
Days post inoculation Days post inoculation
b
BAL-RNA BAL-virus _10 -5 e e
Vi 8 ~ 0 4 QI ID 'ii c
0 0 u 6 I-3 0 0
Ci Ci
,g_4 g 2
"O "O
"' "' .2 2 .2
~ ~ > 0 > 0
0 2 4 0 4
Days post inoculation Days post inoculation
Fig. 21 Viral loads in respiratory samples and bodily fluids. After
inoculation, nose, throat, rectal and urogenital swabs were collected; viral
loads in these samples were determined by qRT-PCR (a). On 1. 3, and 5 dpi,
bronchoalveolar lavages were performed on the 4 animals remaining in the
study through 21 dpi;viral loads and virus titers were determined in these 20 Rectal swabs Urogenital swabs
=:-8 =:-8
E E
Vi Vi ·as ·as
0 0 u u
0 0
Ci 4 Ci 4 g g
"O "O
"' 2 .2 2 .2
~ ~ > 0 > 0
0 10 15 20 0 5 10 15 20
Days post inoculation Days post inoculation
c d
Blood Urine
=:-8 =:-8
E E
Vi Vi .. QI
'ii 6 'ii 6
0 0 u u
0 0
Ci 4 Ci 4 g g
"O "O
"' 2 "' 2 .2 .2
~ ~ > 0 > 0
0 5 10 15 20 21
Days post inoculation Days post inoculation
samples. Viral loads were determined in blood collected during clinical exams
(c) and urine collected at necropsy on 3 and 21 (d). Grey: animals euthanized 3
dpi; black: animals euthanized 2ldpi; red: virus was isolated from these
samples. Identical symbols have been used to denote identical animals this
manuscript.
Nature I www.nature.com I 5
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710045
Article
c
50
"C
,2! 40
~ UI
iJ; -~ 30
Ql UI
~ ;,20
-.c 0 10
?ft. b
3 dpi •3 dpi
•21 dpi
u m u m u m u m
right lobe left lobe right lobe left lobe Days post
inoculation
ventral
Fig. 31 Pathological changes in rhesus macaques infected with SARS-CoV-2.
Four rhesus macaques were euthanized on 3 and 2ldpi. Grossly, lungs showed
focal areasofhilarconsolidation and hyperemia (circles) on 3 dpi (a) and
multifocal, random consolidation and hyperemia (circles) on 2ldpi (b). The
percentage of the area of the lungs affected by gross lesions was estimated (c),
and lung weight to bodyweight r-atio was calculated. (d). The dotted line
represents baseline ratio calculated from an in-house collection ofrhesus
macaque lung and bodyweiglits from animals with grossly normal lungs.
Histological analysis was performed on tissues collected at 3 dpi (e·i). Tissue
sections were colle'cted from the same anatomical location for each animal;
three tissue sections were prepared from each oft he 6 lunglobes. In total, 18
lung sections were evaluated for each animal; representative images are
displayed. (e) Pulmonary vessels surrounded by moderate numbers of
lymphocytes and fewer macrophages (arrows). (f) Alveoli filled with small to
6 I Nature I www.nature.com dorsal
moderate numbers of macrophages and neutrophils (asterisks). Adjacent
alveolar interstitium (arrows) is thickened by edema, fibrin, neutrophils,
lymphocytes and macrophages. (g) SARS·CoV -2 antigen detected by
immunohistochemistry in type I pneumocytes. (h) Pulmonary vessels bounded
by lymphocytes (arrowhead) and hyaline membranes (arrows) line alveolar
spaces. (i) Hyaline membranes line alveoli (arrows). (j) SARS-CoV·2 antigen
detected by immunohistochemistry in type I pneumocytes (asterisk) and type
II pneumocytes (arrow) as well as alveolar macrophages (arrowheads) . (k)
SARS-CoV-2 antigen detected by immunohistochemistry in macrophages in a
mediastinal lymph node. (I) SARS·CoV-2 antigen detected by
immunohistochemistry in macrophages and lymphocytes in the lamina
propria of the cecum. (m) SARS-CoV·2 detected by immunohistochemistry in
type 1 pneumocytes. Magnification : e, h lOOx; f, g, l,j, k, I 400x; m: lOOOx. u:
upper; m: middle; I: lower.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710046
Methods
Ethics and biosafety statement
All animal experiments were approved by the Institutional Animal Care
and Use Committee ofRocky Mountain Laboratories, NIH and carried
out by certified staff in an Association for Assessment and Accredi
tation of Laboratory Animal Care (AAALAC) International accred
ited facility, according to the institution's guidelines for animal use,
following the guidelines and basic principles in the NIH Guide for the
Care and Use of Laboratory Animals, the Animal Welfare Act, United
States Department of Agriculture and the United States Public Health
Service Policy on Humane Care and Use of Laboratory Animals. Rhesus
macaques were housed in adjacent individual primate cages allowing
social interactions, in a climate-controlled room with a fixed light-dark
cycle (12-hr light/12-hr dark). Animals were monitored at least twice
daily throughout the experiment . Commercial monkey chow, treats,
and fruit were provided twice daily by trained personnel. Water was
available ad libitum. Environmental enrichment consisted ofa variety
of human interaction, manipulanda, commercial toys, videos, and
music. The Institutional Biosafety Committee (IBC) approved work
with infectious SARS-CoV-2 strains under BSL3 conditions . Sample
inactivation was performed according to !BC-approved standard oper
ating procedures for removal of specimens from high containment .
Study design
To evaluate the use of rhesus macaques as a model for SARS-CoV-2,
eight adult rhesus macaques (4 males, and4 females, age4-6 years) were
inoculated via a combination of intranasal (0.5ml per nostril), intratra
cheal (4ml),oral (lml) and ocular (0.25ml per eye) ofa 4xl05TCID50/ml
(3xl08 genome copies/ml) virus dilution in sterile DMEM. The animals
were observed twice daily for clinical signs of disease using a standard
ized scoring sheet (Supplementary Information Table SI); the same
person assessed the animals throughout the study. The predetermined
endpoint for this experiment was 3 days post inoculation (dpi) for one
group of 4 animals, and 21 dpi for the remaining 4 animals. Animals
were randomly assigned to a group for necropsy prior to the start of the
experiment . Blinding was not used in this study since all animals were
subjected to the same treatment . Clinical exams were performed on
0, 1, 3, 5, 7, 10, 12, 14, 17 and 21 dpi on anaesthetized animals. On exam
days, clinical parameters such as bodyweight, body temperature and
respiration rate were collected, as well as ventro-dorsal and lateral chest
radiographs . Chest radiographs were interpreted by a board-certified
clinical veterinarian . The following sampies were collected at all clinical
exams: nasal, throat, urogenital and rectal swabs, blood. The total white
blood cell count, lymphocyte, neutrophil, platelet, reticulocyte and
red blood cell counts, hemoglobin, and hematocrit values were deter
mined from EDTA blood with the IDEXX ProCyte DX analyzer (IDEXX
Laboratories). Serum biochemistry (albumin, AST, ALT, GGT, BUN,
creatinine) was analyzed using the Piccolo Xpress Chemistry Analyzer
and Piccolo General Chemistry13 Panel discs (Abaxis). During clinical
exams on 1, 3, and 5 dpi bronchoalveolar lavages were performed using
lOml sterile saline. Of note, repeated bronchoalveolar lavages do not
induce lung damage when space 48 hrs apart27•28• After euthanasia,
necropsies were performed . The percentage of gross lung lesions was
scored by a board-certified veterinary pathologist and samples oft he
following tissues were collected: inguinal lymph node, axillary lymph
node, cervical lymph node, salivary gland, conjunctiva, nasal mucosa,
oropharynx, tonsil, trachea, all six lung lobes, mediastinal lymph node,
right and left bronchus, heart, liver, spleen, pancreas, adrenal gland,
kidney, mesenteric lymph node, stomach, duodenum,jejunum, ileum,
cecum, colon, urinary bladder, reproductive tract (testes or ovaries
depending on sex of the animal), bone marrow, frontal brain, cerebel
lum and brainstem . Histopathological analysis of tissue slides was
performed by a board-certified veterinary pathologist blinded to the
group assignment of the animals. Virus and cells
SARS-CoV-2 isolate nCoV-WAI-2020 (MN985325.1)14 (Vero passage 3)
was kindly provided by CDC and propagated once in VeroE6 cells in
DMEM (Sigma) supplemented with 2% fetal bovine serum (Gibco),
1 mM L-glutamine (Gibco), 50 U/ml penicillin and 50 µg/ml streptomy
cin (Gibco) (virus isolation medium). The used virus stock was 100%
identical to the initial deposited genbanksequence (MN985325.1) and
no contaminants were detected. VeroE6 cells were maintained in DMEM
supplemented with 10% fetal calf serum, 1 mM L-glutamine, 50 U/ml
penicillin and 50 µg/ml streptomycin. VeroE6 cells were provided by
Dr. Ralph Barie and were not authenticated in-house; mycoplasma
testing is performed at regular intervals and no mycoplasma has been
detected.
Quantitative PCR
RNA was extracted from swabs and BAL using the QiaAmp Viral RNA
kit (Qiagen) according to the manufacturer's ins-tructions . Tissues
(30 mg) were homogenized in RLT buffer and RNA was extracted using
the RN easy kit (Qiagen) according to the manufacturer's instructions .
For detection of viral RNA, 5 µI RNA was used in a one-step real-time
RT-PCR E assay29 using the Rotor-Gene probe kit (Qiagen) accord
ing to instructions of the manufacturer. In each run, standard dilu
tions of counted RNA standards were run in parallel, to calculate
copy numbers in the samples. For detection ofSARS-CoV-2 mRNA,
primers targeting open reading frame 7 (ORF?) were designed
as follows: forward primer 5'-TCCCAGGTAACAAACCAACC-3',
reverse primer 5'-G<ZTCACAAGTAGCGAGTGTTAT -3', and probe
FAM-ZEN-CTTGTAGATCTGTTCTCTAAACGAAC-IBFQ . 5 µI RNA was
used in a one-step real-time RT-PCR using the Rotor-Gene probe kit
(<'.!iagen) according to instructions of the manufacturer. In each run,
standard dilutions of counted RNA standards were run in parallel, to
calculate copy numbers in the samples.
Histopathology and immunohistochemistry
Histopathology and immunohistochemistry were performed on
rhesus macaque tissues. After fixation for a minimum of? days in
10% neutral-buffered formalin and embedding in paraffin, tissue
sections were stained with hematoxylin and eosin (HE). To detect
SARS-CoV-2 antigen, immunohistochemistry was performed using
an anti-SARS nucleocapsid protein antibody (Novus Biologicals) at a
1:250 dilution. This antibody was first tested on SARS-CoV-2 infected
and uninfected Vero E6 cell pellets, showing specific staining with
infected cells and no staining with uninfected cells. The antibody
showed specific staining with infected experimental tissue and no
staining with uninfected tissue from rhesus macaques. Infected tissue
and cell pellet specimens showed no staining when run with Rabbit
IgG controls (non-specific rabbit IgG substituted for primary anti
body). Stained slides were analyzed by a board-certified veterinary
pathologist.
Transmission electron microscopy. After fixation for 7 days with
Karnovsky's fixative at4 °C, excised tissues were post-fixed for 1 hour
with 0.5% osmium tetroxide/0.8% potassium ferricyanide in 0.1 M
sodium cacodylate, washed 3 x 5 minutes with O.IM sodium caco
dylate buffer, stained 1 hour with 1% tannic acid, washed with buffer
and then further stained with2% osmium tetroxide in O.IM sodium
cacodylate and overnight with 1% uranyl acetate at 4 °C. Specimens
were dehydrated with a graded ethanol series with two final exchanges
in 100% propylene oxide before infiltration and final embedding in
Embed-812/Araldite resin. Thin sections were cut with a Leica EM
UC6 ultra microtome (Leica, Vienna, Austria), prior to viewing at120
kV on a Tecnai BT Spirit transmission electron microscope (Thermo
fisher/FE!, Hillsboro, OR). Digital images were acquired with a Gatan
Rio bottom mount digital camera system (Gatan Inc., Pleasanton, CA
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710047
Article
and processed using Adobe Photoshop v. CC 2019 (Adobe Systems
Inc, Sanjose, CA).
Serum cytokine and chemokine analysis. Serum samples for analy
sis of cytokine/chemokine levels were inactivated with y-radiation
(2 M Rad) accordingtostandard operating procedures. Concentrations
of granulocyte colony-stimulating factor, granulocyte-macrophage
colony-stimulating factor, interferon (IFN)-y, interleukin (IL)-113.
IL-1 receptor antagonist, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12/23 (p40),
IL-13, IL-15, IL-17, MCP-1 and macrophage inflammatory protein
(MIP)-la, MIP-ll), soluble CD40-ligand (sCD40L), transforming
growth factor-a, tumor necrosis factor (TNF)-a, vascular endothe
lial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200
instrument (Bio-Rad) using the Non-Human Primate Cytokine MIL
LIPLEX map 23-plex kit (Millipore) according to the manufacturer's
instructions.
Serology
Sera were analyzed by SARS-CoV-2 spike protein (S) enzyme-linked
immunosorbent assay (ELISA) as done previously for MERS-CoV30•
Briefly, maxisorp (Nunc) plates were coated overnight with 100 ng/well
S protein diluted in PBS31 (a kind gift of Barney Graham, Vaccine
Research Center, NIH) and blocked with blocker casein in PBS (Life Tech
nologies). Sera were serially diluted in duplicate. SARS-CoV-2-specific
antibodies were detected using anti-monkey IgG polyclonal antibody
HRP-conjugated antibody (KPL), peroxidase-substrate reagent (KPL)
and stop reagent (KPL). Optical density (OD) was measured at405 nm.
The threshold of positivity was calculated by taking the average oft he
day 0 values multiplied by 3.
For neutralization, sera were heat-inactivated (30 min, 56 °C) and
two-fold serial dilutions were prepared in 2% DMEM. Hereafter, 100
TCID50 ofSARS-CoV-2 was added. After 60 min incubation at 37 °C,
virus:serum mixture was added to VeroE6 cells and incubated at 37 °C
and 5% C02. At5 dpi, cytopathic effect was scored. The virus neutraliza
tion titer is expressed as the reciprocal value of the highest dilution of
the serum which still inhibited virus replication. All sera were analyzed
in duplicate. Reporting summary
Further information on research design is available in the Nature
Research Reporting Summary linked to this paper.
Data availability
Data have been deposited in Figs hare: https://doi.org/10.35092/
yhjc.12026910.
27. Haley, P. J., Muggenburg, B. A., Rebar, A.H., Shopp, G. M. & Bice, D. E. Bronchoalveolar
lavage cytology in cynomolgus monkeys and identification of cytologic alteration s!'
following sequential saline lavage. Vet Pathol 26, 265-273, https,//doi.org/
10.1177/030098588902600312 (1989).
28. Krombach , F. et al. Short-term and long-term effects of serial bronchoalveolar lavages in
a nonhuman primate model. Am J Respir Grit Care Med 150, 153-158, https,//doi.org/
10.1164/ajrccm.150.1.8025742 (1994).
29. Corman, V. M. et al. Detection of 2019 novel coronavirus (-2019-nCoV) by real-time RT-PCR.
Euro Surveill 25, httpsJ/doi.org/10.2807/1560-7917.ES.2020.25.3.2000045 (2020).
30. van Doremalen, N. et al. High Prevalence of Middle East Respiratory Coronavirus in Young
Dromedary Camels in Jordan. Vector Borne Zoonotic Dis 17, 55-159, httpsJ/doi.org/
10.1089/vbz.2016.2062 (2017).
31. Wrapp, D. et al. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation.
Science 367, 1260-1263, httpsJ/doi.org/10.1126/science.abb2507 (2020).
Acknowledgements The authors would like to thank Susan Gerber and Natalie Thornburg
(CDC) for providing the SARS-CoV-2 isolate used in this study; Barney Graham, Kizzmekia
Corbett and Olubukola Abiona at the Vaccine Research Center (NIAID, NIH) for providing spike
protein for serology; Anita Mora (NIAID, Nib!) for help with figure design and staff of the Rocky
Mountain Veterinary Branch (NIAID, NIH) for animal care. This study was supported by the
Intramural Research Program, NIAID, NIH.
Author contributions VJM and EdW designed the study; VJM, FF, BW, NvD, LPP, JS, KMW, AO,
JC, BB, VAA, RR, PH, GS, EF, DS and EdW acquired, analyzed and interpreted the data; VJM, PH,
EF, DS and EdW wrote the manuscript. All authors have approved the submitted version.
Competing interests The authors declare no competing interests.
Additional information
.Supplementary information is available for this paper at https,//doi.org/10.1038/s41586-020-
2324-7.
Correspondence and requests for materials should be addressed to E.d.W.
Peer review information Nature thanks Wolfgang Baumgartner, Menno D. de Jong and Patricia
Pesavento for their contribution to the peer review of this work.
Reprints and permissions information is available at http://www.nature.com/reprints.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710048
Extended Data Fig. I I Pulmonary infiltrates in a rhesus macaque after
inoculation. Radiographs show the progression of pulmonary infiltrates
throughout the study in a single animal. Of note, this animal is denoted with a
black triangle throughoutthe manuscript. Circles indicate areas of mild to moderate pulmonary infiltrates. A marker'R' indicates right side of the animal.
Three chest radiographs were taken at each timepoint: right-lateral, left-lateral
and ventro-dorsal; only the ventro-dorsal radiograph is shown.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710049
Article
25
~20 :i g 15 White blood cells
~ 10 f]' ~-------=t~~ ::::---
$: 5
o+--~-~--~-~
0 10 15 20
Days post inoculation
Hematocrit
;,::~
~E~
0 5 10 15 20
Days post inoculation Neutrophils
Days post inoculation
Red blood cells
Days post inoculation
Extended Data Fig. 21 Hematological changes in rhesus macaques infected
with SARS-CoV-2. Identical symbols have been used to denote identical Lymphocytes
io~l~~
~~
0 5 10 15 20
Days post inoculation
Hemoglobin
0 5 10 15 20
Days post inoculation '3: 300 g
Ill 200
~ u
0 :;
u
~ 0 Monocytes
10 15
Days post inoculation
Reticulocytes
5 10 15 20
Days post inoculation
animals throughout the figures in this manuscript. n= 8 animals on 0, 1, and 3
dpi and n=4 animals thereafter.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710050
15000
~10000
.e:
~ ";' 5000
:::! p=<0.0001
5 IL-1ra
10 15
Days post inoculation
MCP-1
10000 p=<0.0001
~ 8000
~ 6000
0.. 4000 20
~ 2000 ~
o.f-..c1:,,..,...,=t-...,,,,...,.,,._ ~
0 5 10 15 20
Days post inoculation 80
"E 60 Ci
~ 40
-;[_ 20
:E IL-6
5 10 15
Days post inoculation
MIP-1b
5 10 15
Days post inoculation
Extended Data Fig. 31 Cytokine and chemokine levels in serum of rhesus
macaques infected with SARS-CoV-2. The levels of23 cytokines and
chemokines were determined in serum at different timepoints after
inoculation. Levels are displayed only for those cytokines and chemokines
where statistically significant (1-way A NOVA) we re observed compared to 20
20 IL-10
1500 p=0.0137
~1000
.e:
0
~ 500
20
"E 15
~ -10
~ 5 10 15
Days post inoculation
TGFa
~ 5.U~-.:::t~~"11'-.C*~
5 10 15
Days post inoculation 20
20 80
~ 60
Ci .e: 40
It>
~ 20 IL-15
p=<0.0001
5 10 15 20
Days post inoculation
levels on day of inoculation. Identical symbols have been used to denote
identical animals throughout the figures in this manuscript . The lower limit of
detection is indicated with a dotted line. Serum samples were analyzed in
duplicate from each animal for each timepoint; n= 8 animals on 0, 1, and 3 dpi
and n=4 animals thereafter .
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710051
Article
Extended Data Fig. 41 Histological lesions in lungs of a rhesus macaque
infectedwithSARS-CoV-2. (a) This low magnification figure displays the focal
natureofSARS-CoV-2 lesions in the lungs of animals euthanized on 3 dpi. The
circle indicates the lung affected by lesion; the remaining lung tissue is healthy.
(b) Lymphocytes surround pulmonary vessels. Magnification SO Ox. Tissue sections were collected from the same anatomical location for each animal;
three tissue sections were prepared from each of the 6 lung lobes. In total, 18
lung sections were evaluated for each animal (n=4); representative images are
displayed .
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710052
Extended Data Fig. 51 Histological changes in the respiratory tract of
rhesus macaques infected with SARS-CoV-2. (a) Squamous metaplasia of
nasal turbinate respiratory epithelium (arrow). Magnification400x. (b)
SARS-CoV-2 antigen is detected by immunohistochemistry in respiratory
epithelium of the nasal turbinate. Magnification 400x. (c) Essentially normal
tonsil. Magnification 400x. (d) SARS-CoV-2 antigen is detected by
immunohistochemistry in tonsillar macrophages. Magnification 400x. (e) Squamous metaplasia of tracheal columnar epithelium (arrow). Magnification
400x. (f) SARS-CoV-2 antigen is detected by immunohistochemistry in tracheal
columnar epithelium . Magnification 400x. Tissue sections were collected
from the same anatomical location for each animal (n=4) and organ; one tissue
section was evaluated of the nasal turbinates of each animal; three tissue
sections were evaluated from tonsil and trachea.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710053
Article
Extended Data Fig. 6 I SARS-CoV-2 antigen in the gastrointestinal tract of a
rhesus macaque infected with SARS-CoV-2. Mononuclear cells staining
positive for SARS-CoV-2 antigen in the lamina propria of stomach (a),
duodenum (b),jejunum (c), ileum (d), cecum (e) and colon (f) of an animal infected with SARS-CoV-2 and euthanized on 3dpi. Tissue sections were
collected from the same anatomical location for each animal (n=4) and organ;
three tissue sections were evaluated from each animal and organ.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710054
Extended Data Fig. 71 Ultrastructural analysisoflungs of rhesus macaques
infected with SARS-CoV-2. Lung tissue collected on 3 dpi was analyzed by
transmission electron microscopy. The alveolar interstitium is expanded by
edema (E), fibrin (F) and mononuclear (M) inflammatory cells (a). Normal
collagen fibers (c) and multiple virions (arrowheads) line type I pneumocytes (arrows). Boxes in (a) indicate areas enlarged in (b-d). Scale bar in (a) represents
2µm, scale bars in (b·e) represent 0.2 µm. Three tissue samples were collected
from each animal (n=4) and cut into 6 samples for analysis; a minimum of2
samples wereianalyzed per animal (n=4).
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710055
Article
a
_ 10
~
~
-~
~
" 0
"§ >
c
~
~
·~
"' 0
" .2
"§
> • .
• .. • .. . ... ... . .. .. . • •
upper middle lower upper middle lower
right lobe left lobe
• • • b 10
T • • .... .... •
Nasal OropharynxTrachea R
muscosa Bronchus Bronchus
• • •
Inguinal Axillary Cervical MediastinalMesenteric Tonsil Spleen Bone marrow
LN LN LN LN LN
d e
4
"E
~
~ I
~
-~ -~
• • "' 0
"' 0 • 0
" " .2 .2
"§
> ;;
$
Stomach Duodenum Jejunum Ileum Cecum Colon Frontal Cerebellum Brainstem
brain
•
• •
Salivary Conjunctiva Heart Liver Pancreas Adrenal Kidney Urinary Reproductive
gland
g
... .. . .
3 3 3 " i ·~ j 3 ~ ..J ..J ..J ..J ..J f " :; ..J 3 :: ;; "' ~ c, ~ ~ ::c "' 0: 0:
I -~ ;:- ~ : ·x
.~ -~ g-
"' 0 0 ii
~ 0
~
Extended Data Fig. 81 Viral loads in tissues collected from rhesus macaques
infected with SARS-CoV-2. Eight adult rhesus macaques were inoculated with
SARS-CoV -2 isolate nCoV-WAl-2020 and euthanized on 3 (n=4) and 21 (n=4) dpi.
Thirty-seven tissues were collected at necropsy and analyzed for the presence
of viral RNA by qRT-PCR. Tissues are grouped by lung lobes collected on 3 dpi
(a), with red symbols indicating tissues from which virus could be isolated in
Vero E6 cells; other tissues from the respiratory tract on 3dpi (b); lymphoid
tissues on 3 dpi (c);gastrointestinal tissueson 3 dpi (d); the central nervous ..J ..J ..J gland bladder tract
~ " >. 3 ! j § 0 ~ " ::;
~ c, " u ~ 0 " g c " 0 0
~ ~ ~ ~ :;; l
~ ~ ~ ~
cl!
ii: "' :; :5
system on 3 dpi (e); remaining tissues on 3 dpi (f); and all tissues collected on 21
dpi (g)_ Blue symbols in b-g indicate that viral mRNA was also detected in these
tissues. Identical symbols have been used to denote identical animals
throughout the figures in this manuscript . LN: lymph node; RUL: right upper
lung lobe; RML: right middle lung lobe; RLL: right lower lung lobe; LUL: left
upper lung lobe; LML: left middle lung lobe; LLL: left lower lung lobe; R: right; L:
left.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710056
a b
3200
~ 80
c:
0
2 2400 ~ 60 :;::; .!::! < ~ Ill :J :; w .,
;;; 1600 c: 40
"' CJ ::I 0 ·$ ii ·;::; 800 ;;; 20 ., CJ 0:: 0 ii ·;::;
<100 ., <10 0::
0 5 10 15 20 0 5 10 15 20
Days post inoculation Days post inoculation
Extended Data Fig. 91 Antibody response in rhesus macaques infected with antibodies in a microneutralization assay (b). All sera were analyzed in
SARS-CoV-2. Sera collected after inoculation were tested for the presence of duplicate . Identical symbols have been used to denote identical animals
lgG against SARS-CoV-2 spike in ELISA (a) and for the presence of neutralizing throughout the figures in this manuscript.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710057
Article
Extended Data Table 11 Clinical signs observed in rhesus macaques inoculated with SARS-CoV-2
Animal Clinical signs observed 1-6 dpi Clinical signs observed 7-21 dpi Observations at necropsy*
RM1
-R_M_2~~~~P-ilo_e_r-ec-t-io-n-;d_y_s_p-ne_a_;_r-ed_u_c_e_d_a_p_p_e_tit_e_·~~-N- /-A~~~~~~~~~~~~~~~~F-lu-id---fil-le_d_s-to-m~ac_h_ ._s_m_a_ll_a_n_d~~ "~ ~.....,,,,.. Euthanized 3 dpi. large intestine. ~
RMJ Piloerection; tachypnea; flushed N/A Epistaxis. Gross lung lesions.
appearance ; reduced appetite; mildly Enlarged mediastinal lymph nodes.
RM4
RMS
RM6
RM7
RMB dehydrated. Fluid-filled stomach, small and
Euthanized 3 dpi. large intestine.
Hunched posture; piloerection; tachypnea ;
dyspnea; reduced appetite.
Euthanized 3 dpi.
Hunched posture; piloerection; tachypnea ;
dyspnea; reduced appetite.
Hunched posture; piloerection; tachypnea ;
dyspnea; reduced appetite; serous nasal
discharge.
Hunched posture; piloerection ; pale
appearance ; tachypnea ; dyspnea; irregular;
labored respirations ; anorexia; mildly
dehydrated ; serous nasal discharge.
Hunched posture; piloerection; pale
appearance ; increased , dyspnea; reduced
appetite; serous nasal discharge. N/A
Tachypnea; dyspnea; reduced appetite;
mildly dehydrated.
Recovered on 9 dpi.
Piloerection ; bradypnea; mildly de~ydrated;
crusty nasal discharge. I
Recovered on 10 dpi.
Hunched posture; piloerection; pale
appearance ; tachypnea ; dyspnea; reduced
appetite; mildly dehydrated; crusty nasal
discharge.
Recovered on 17 dpi.
Hunched posture; piloerection; pale
appearance; increased , dyspnea; nasal
discharge; reduced appetite; mildly
dehydrated ; serous nasal discharge.
Recovered on 13 dpi. Gross lung lesions. Foamy exudate
from trachea.
Enlarged mediastinal lymph nodes.
Fluid-filled stomach, small and
large intestine.
Gross lung lesions.
Enlarged mesenteric lymph nodes.
None.
None.
Gross lung lesions.
*Incidental observations not related to coronavirus infection were o itted from this table.
090177e1946ab937\Final\Final On: 17-Jul-2020 18:31 (GMT)
FDA-CBER-2021-5683-0710058